Rnaimax

Manufactured by Merck Group

Sourced in France

RNAiMAX is a transfection reagent developed by Merck Group. It is designed for the effective delivery of small interfering RNA (siRNA) and other nucleic acids into a variety of mammalian cell lines. RNAiMAX provides efficient transfection with minimal cytotoxicity.

Automatically generated - may contain errors

Lab products found in correlation

Rnaimax, by Thermo Fisher Scientific (6 mentions) Silrp1 or sictrl duplexes, by Merck Group (2 mentions) Roswell park memorial institute (rpmi), by Merck Group (2 mentions) Siglo green, by Horizon Discovery (1 mentions) Genetran, by Biomiga (1 mentions) Cloud chamber, by Vitrocell (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions) Cgamp, by Thermo Fisher Scientific (1 mentions) Herring testes dna ht dna, by Merck Group (1 mentions) Mitochondrial isolation kit for mammalian cells, by Thermo Fisher Scientific (1 mentions) Cgamp, by Merck Group (1 mentions) Qiaamp dna mini kit, by Thermo Fisher Scientific (1 mentions) Dnase 1, by Merck Group (1 mentions) Control sirna, by GE Healthcare (1 mentions)

12 protocols using rnaimax

Transfection of Diverse Nucleic Acids

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection of siRNA, cGAMP, mtDNA, herring testis (HT), or plasmid DNA was performed using RNAiMax according to the maunfacturer's instructions (Invitrogen). mtDNA was isolated from mitochondria using the Mitochondrial Isolation Kit for Mammalian cells (Thermo Fisher Scientific) and mtDNA was purified by QIAamp® DNA Mini Kit. Mouse mtDNA was prepared from PolgA^+/+ MEFs and human mtDNA was prepared from primary human skin fibroblasts. Herring Testes DNA (HT‐DNA) was purchased from Sigma‐Aldrich (D6898).
Mouse mtDNA, human mtDNA, or mtDNA that had been digested by 20 μg/ml DNase I (Sigma‐Aldrich) for 30 min at 37°C as DNase I‐pretreated mtDNA, were transfected with RNAiMax for 48 h. 4 μg/ml cGAMP (Sigma‐Aldrich, 5.31889.0001) was transfected with RNAiMax for 24 h. Mouse mtDNA was transfected at a concentration of 100 ng/ml into MEFs or pmAT2. Human mtDNA was used at a concentration of 200 ng/ml for phLF transfection. siRNAs were transfected for 48 h at a final concentration of 5 nM. Details on the siRNAs applied in this study are provided in Table EV4. HT‐DNA or plasmid DNA was transfected at a concentration of 1 μg/ml.

Wang X., Zhang H., Wang Y., Bramasole L., Guo K., Mourtada F., Meul T., Hu Q., Viteri V., Kammerl I., Konigshoff M., Lehmann M., Magg T., Hauck F., Fernandez I.E, & Meiners S. (2023). DNA sensing via the cGAS/STING pathway activates the immunoproteasome and adaptive T‐cell immunity. The EMBO Journal, 42(8), e110597.

+ Open protocol

+ Expand

Transfection and ROS Measurement in MEFs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genetran (Biomiga) was used to transfect HEK239T cells with miR-34c-minigene and pCDNA3-AblPPn plasmid DNA (Tu et al., 2015 (link)). Transfected cells and their media (for EV isolation) were collected 24 h after transfections. RNAiMAX was used to transfect MEFs with control mimic (CGGUACGAUCGCGGCGGGAUAUC) and miR-34c mimic (AGGCAGUGUAGUUAGCUGAUUGC) (Sigma). The transfection efficiency was ∼80%, as determined by siGLO green (Dharmacon). The ROS levels in live transfected cells were measured at 24 h posttransfection as described above.

Rastogi S., Hwang A., Chan J, & Wang J.Y. (2018). Extracellular vesicles transfer nuclear Abl-dependent and radiation-induced miR-34c into unirradiated cells to cause bystander effects. Molecular Biology of the Cell, 29(18), 2228-2242.

+ Open protocol

+ Expand

TRPM8 Knockdown and Menthol Aerosol Exposure

Check if the same lab product or an alternative is used in the 5 most similar protocols

BEAS-2B cells were attached for 24 h in 12-well transwell inserts using serum free BEGM medium without antibiotics. Knockdown of TRPM8 and an iLamin control was carried out using siRNA (Sigma-Aldrich) and lipofectamine RNAiMAX according to the manufacturer’s instructions. 24 h after transfection, medium was removed, and fresh medium was added to the basal layer. Transwells were exposed to menthol aerosol (0.8 mg/mL) in the VITROCELL® cloud chamber, and 24 h later, expression of proteins was analyzed using western blotting.

Nair V., Tran M., Behar R.Z., Zhai S., Cui X., Phandthong R., Wang Y., Pan S., Luo W., Pankow J.F., Volz D.C, & Talbot P. (2020). Menthol in Electronic Cigarettes: A Contributor to Respiratory Disease?. Toxicology and applied pharmacology, 407, 115238.

+ Open protocol

+ Expand

Transcription Factor Silencing in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

N2A cell lines were transfected with 10 nM of U2af65, Ccar1 or Ptbp1 ON-TARGETplus siRNA pools (Thermo Scientific-Dharmacon) using RNAiMax (Life Technologies), as recommended by the manufacturer. 293T cells were transfected with 25 nM each of PTBP1 and PTBP2 siRNAs (Sigma-Aldrich) using RNAiMax. A non-targeting siRNA pool was used as control. N2A and 293T cells were harvested 48 h and 72 h, respectively, post-transfection.

Raj B., Irimia M., Braunschweig U., Sterne-Weiler T., O’Hanlon D., Yuan-Lin Z., Chen G.I., Easton L., Ule J., Gingras A.C., Eyras E, & Blencowe B.J. (2014). Global regulatory mechanism underlying the activation of an exon network required for neurogenesis. Molecular cell, 56(1), 90-103.

+ Open protocol

+ Expand

Gymnotic and Transfection-Mediated ASO Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

All ASOs were dissolved in PBS. ASO treatments were performed either without transfection reagents (gymnotic delivery) or using Lipofectamine RNAiMAX (Invitrogen; catalog number: 13778075). For gymnotic delivery, cells were seeded in complete growth medium and the following day, ASOs were added to the growth medium at desired final concentrations. For RNAiMAX-mediated transient transfection, cells were seeded in complete growth medium in six-well plates (Sigma-Aldrich; catalog number: CLS3516) and the following day, 100 pmol ASOs were added according to the manufacturer’s protocol. After 48 or 72 h, the cells were harvested for further analysis.

Li Y., Mondaza-Hernandez J.L., Moura D.S., Revenko A.S., Tolentino A., Nguyen J.T., Tran N., Meyer C.A., Merino-Garcia J., Ramos R., Di Lernia D., Martin-Broto J., Hayenga H.N, & Bleris L. (2024). STAT6-targeting antisense oligonucleotides against solitary fibrous tumor. Molecular Therapy. Nucleic Acids, 35(2), 102154.

+ Open protocol

+ Expand

Epigenetic Regulation via MBD2 Silencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the CAF-CM treatment, cells were seeded at 1.10⁵ per well in six-well plates. The following day, cells were cultured in CAF-CM for 48 h. For MBD2 siRNA experiments, cells were seeded at 3.10⁵ per well in six-well plates. The day after, cells were transfected with 100 pmol of MBD2-targeting siRNA (siMBD2; sense: 5′-GGAGGAAGUGAUCCGAAAdTdT-3′)^{39 (link)} or control siRNA (Sigma-Aldrich, MISSION siRNA Universal Negative Controls #1) using RNAiMAX (Sigma-Aldrich, Saint-Quentin-Fallavier, France) as specified by the manufacturer’s instructions. Cells were collected 72 h after treatment initiation. For the DAC treatment, cells were seeded at 1.10⁵ per well in six-well plates. The following day, cells were treated daily with 10 μM of DAC (Sigma-Aldrich) for 3 days and were then collected.

Mathot P., Grandin M., Devailly G., Souaze F., Cahais V., Moran S., Campone M., Herceg Z., Esteller M., Juin P., Mehlen P, & Dante R. (2017). DNA methylation signal has a major role in the response of human breast cancer cells to the microenvironment. Oncogenesis, 6(10), e390-.

+ Open protocol

+ Expand

Investigating HDAC11 knockdown in 4T1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

4T1 cells were plated at 40% confluency in 6-well plates, after which the cells were transfected with siHDAC11 or siCtrl duplexes (60 nM final concentration; Sigma, St. Louis, MO) using RNAiMAX according to the protocol recommended by the manufacturer. The transfection was conducted for the indicated amount of time before the cells were collected and analyzed. The following siRNA constructs were used (sense strand displayed): siCtrl, UUCUCCGAACGUGUCACGUdTdT; siHDAC11-1, CUAUCAAGUUCCUGUUUGAdTdT; siHDAC11-2, GUGACAAGCGAGUAUACAUdTdT.

Leslie P.L., Chao Y.L., Tsai Y.H., Ghosh S.K., Porrello A., Van Swearingen A.E., Harrison E.B., Cooley B.C., Parker J.S., Carey L.A, & Pecot C.V. (2019). Histone deacetylase 11 inhibition promotes breast cancer metastasis from lymph nodes. Nature Communications, 10, 4192.

+ Open protocol

+ Expand

Knockdown of LRP1 in HCT116 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCT116 cells were plated at 40% confluency in 6-well plates, after which the cells were transfected with siLRP1 or siCtrl duplexes (40 μM; Sigma, St.Louis, MO) using RNAiMAX according to the protocol recommended by the manufacturer. The transfection was conducted for either 72 hr or for the indicated amount of time before the cells were collected and analyzed. The following small interfering RNA (siRNA) constructs were used (sense strand displayed): siCtrl, 5ˊ-CAG UCGCGUUUGCGACUGG[dT][dT]-3ˊ; siLRP1–1, 5ˊ-GACUUGCAGCCCCAAG CAGUU[dT][dT]-3ˊ; siLRP1–2, 5ˊ-GCAGUUUGCCUGCAGAGAUUU[dT][dT]-3ˊ.

Leslie P.L., Franklin D.A., Liu Y, & Zhang Y. (2018). p53 Regulates the Expression of LRP1 and Apoptosis through a Stress Intensity-Dependent MicroRNA Feedback Loop. Cell reports, 24(6), 1484-1495.

+ Open protocol

+ Expand

Knockdown of LRP1 in HCT116 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Leslie P.L., Franklin D.A., Liu Y, & Zhang Y. (2018). p53 Regulates the Expression of LRP1 and Apoptosis through a Stress Intensity-Dependent MicroRNA Feedback Loop. Cell reports, 24(6), 1484-1495.

+ Open protocol

+ Expand

siRNA Transfection Protocol for PANC-1 and M579 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Briefly, for siRNA transfections, RNAiMAX (Thermo Scientific) was used. Two hundred microlitres of 250 nM siRNA solution was added to each well of a six-well plate. Four microlitres of RNAiMAX transfection reagent was diluted in 200 µL of RPMI (Merck Millipore) and incubated for 10 min at RT. Four hundred microlitres of RPMI was added, and 600 µL of RNAiMAX mix was given to the wells coated with siRNA and incubated for 30 min at RT. PANC-1 (2×10⁵, wild type (WT) or PANC-1-luc), or 4×10⁵ M579 cells were resuspended in 1.2 mL DMEM medium containing 10% FCS, seeded in the siRNA-RNAiMAX containing wells, and incubated for 72 hours at 37°C, 5% CO₂. For 96-well plate transfection, the aforementioned protocol was proportionally scaled down. All siRNAs were purchased from Dharmacon (Horizon). SIK3 siRNA deconvolution experiment was performed using siGENOME siRNA reagents–set of 4. The SIK3 siRNA sequence 1 was used for all other experiments.

Sorrentino A., Menevse A.N., Michels T., Volpin V., Durst F.C., Sax J., Xydia M., Hussein A., Stamova S., Spoerl S., Heuschneider N., Muehlbauer J., Jeltsch K.M., Rathinasamy A., Werner-Klein M., Breinig M., Mikietyn D., Kohler C., Poschke I., Purr S., Reidell O., Martins Freire C., Offringa R., Gebhard C., Spang R., Rehli M., Boutros M., Schmidl C., Khandelwal N, & Beckhove P. (2022). Salt-inducible kinase 3 protects tumor cells from cytotoxic T-cell attack by promoting TNF-induced NF-κB activation. Journal for Immunotherapy of Cancer, 10(5), e004258.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!