Human CRC cell lines SW620, SW480, HT29, HCT116, and Caco-2 derived from normal human colon were all acquired from the American Type Culture Collection (ATCC; Manassas, VA, USA). The SW620 and SW480 cells were cultured in Leibovitz’s L-15 Medium (Thermo Fisher Scientific, Waltham, MA, USA) and the other CRC cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) medium (Thermo Fisher Scientific). All these media contained 10% fetal bovine serum (Thermo Fisher Scientific) and were maintained at 37°C with 5% CO2. CSCs in SW620 and SW480 were enriched for CSC-related experiments. The SW620 and SW480 cells were transferred into the stem cell-culturing medium, serum-free DMEM/F12 medium, which consists of 20 ng/mL human epidermal growth factor (Peprotech Inc, Rocky Hill, NJ, USA), 20 ng/mL human basic fibroblast growth factor (Peprotech Inc), and 1% N2 supplement (Thermo Fisher Scientific).
Sw480
Manufactured by Thermo Fisher Scientific
Sourced in United States, China, Germany, United Kingdom, Austria, France
The SW480 is a laboratory equipment product from Thermo Fisher Scientific. It is a cell line derived from a human colorectal adenocarcinoma. This product is a commonly used in vitro model for colorectal cancer research.
Automatically generated - may contain errors
Lab products found in correlation
Hct116, by Thermo Fisher Scientific (186 mentions)
Sw480, by American Type Culture Collection (173 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (165 mentions)
Sw620, by Thermo Fisher Scientific (144 mentions)
Hct116, by American Type Culture Collection (132 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (97 mentions)
Sw620, by American Type Culture Collection (90 mentions)
Ht 29, by Thermo Fisher Scientific (82 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (77 mentions)
Rpmi 1640, by Thermo Fisher Scientific (69 mentions)
Dld 1, by Thermo Fisher Scientific (47 mentions)
Caco 2, by Thermo Fisher Scientific (42 mentions)
Dld 1, by American Type Culture Collection (39 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (35 mentions)
Mccoy s 5a medium, by Thermo Fisher Scientific (33 mentions)
Ncm460, by Thermo Fisher Scientific (32 mentions)
Penicillin, by Thermo Fisher Scientific (29 mentions)
Streptomycin, by Thermo Fisher Scientific (28 mentions)
Hct15, by Thermo Fisher Scientific (28 mentions)
Caco 2, by American Type Culture Collection (27 mentions)
335 protocols using sw480
1
Establishing and Maintaining Colorectal Cancer Cell Lines
2
CRC Cell Lines and TGF-β Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human embryonic kidney cell line 293T (HEK293T), immortalized colon mucosa epithelial cell line (FHC), and human CRC cell lines HT29, LoVo, HCT116, SW480, DLD1, LS174t, SW620 and RKO were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). A subclone named M5, which has enhanced metastatic abilities in the liver, was isolated by the in vivo selection of SW480 cells in our laboratory.16 All CRC cell lines were cultured in RPMI 1640 medium (Gibco, Gaithersburg, MD, USA) with 10% fetal bovine serum (FBS, Gibco) and 100 U/ml penicillin/streptomycin (Gibco). 293T cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS. FHC cells were cultured in DMEM:F12 medium (Gibco) with 10% FBS, 25 mmol/L HEPES, 10 mg/L cholera toxin, 5 mg/L insulin, 5 mg/L transferrin, 100 mg/L hydrocortisone, and 20 mg/L human recombinant epidermal growth factor (EGF). To examine the effects of TGF‐β signaling, LoVo, HCT116, SW480 and HT29 cells were treated with 10 ng/mL recombinant human TGF‐β1 (PeproTech Inc, Rocky Hill, NJ, USA) for 48 h, or with 1 μΜ TGFβR1 inhibitor (SB525334, Selleckchem, Houston, TX, USA) for 48 h, respectively. All of the cell lines were cultured at 37°C and in 5% CO2 in air in an humidified incubator.
3
Establishing Oxaliplatin-Resistant Colorectal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Six human colorectal cancer cell lines HCT116, SW480, HT29, SW620, Caco2 and LOVO were obtained from the Shanghai Institute of Cell Biology (Shanghai, China).The related oxaliplatin-resistant cell lines SW480-OxR and HCT116-OxR were generated by continuous exposure to increasing concentrations of oxaliplatin for a 10-month period as described previously 23 (link). We performed cytotoxicity testing to confirm that chemoresistance could be stable for about 4 weeks without oxaliplatin exposure. The oxaliplatin-resistant cell lines were used at no higher than 15 passages from creation. All cells were cultured in the appropriate medium (RPMI-1640 for HT29, SW620, SW480 and SW480-OxR cells; DMEM for Caco2, LOVO, HCT116 and HCT116-OxR cells) supplemented with 10% FBS (Gibco, Carlsbad, CA, USA) in a humidified atmosphere with 5% CO2 at 37 °C.
4
Isolation and Culture of Human Hepatocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human primary hepatocytes were provided by BioreclamationIVT (F00995-P and M00995-P, Hicksville, New York, USA), and the clinical characteristics of the donors are shown in Supplementary Table 1 . Human primary hepatocytes were thawed in INVITROGROTM CP Medium (S03316, BioreclamationIVT, Hicksville, New York, USA) supplemented with 10% fetal bovine serum (16140071, Gibco, New York, USA) at 37 °C in a 5% CO2 incubator for 24 h and then replaced with INVITROTM HI Medium (Z99009, Hicksville, New York, USA). HL-7702 (JNO-048) was purchased from GuangZhou Jennio Biotech Co.,Ltd. (Guangzhou, Guangdong, China), SW-480 (TCHu 86), HCT-116 (TCHu 99), Bel-7402 (TCHu 10), Hep-G2 (TCHu 72), and HEK-293T (GNHu 18) cells were originally obtained from the Cell Bank of China Science Academy. HL-7702, SW-480, HCT-116 and Bel-7402 cells were maintained in RPMI-1640 (21870076, Gibco, New York, USA), while HEK-293T and Hep-G2 cells were maintained in DMEM (10569010, Gibco, New York, USA) with 10% fetal bovine serum (16140071, Gibco, New York, USA), 100 U/mL penicillin and 100 μg/mL streptomycin (15140122, Gibco, New York, USA) in a humidified atmosphere with 5% CO2. All cell lines were routinely tested to be negative for mycoplasma contamination.
5
Culturing CRC Cell Lines SW480 and HCT116
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRC cell lines SW480 and HCT116 were purchased from Type Culture Collection of the Chinese Academy of Science (Shanghai, China). SW480 cells were cultured in RPMI 1640 Medium (118575-093, Invitrogen, Shanghai, China) supplemented with 10% fetal bovine serum (10099141C, Gibco, Shanghai, China) and 100 μg/mL antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin, Gibco). HCT116 cells were cultured in McCoy's 5A Medium (16600-082, Gibco). During glutamine starvation, SW480 cells were cultured in glutamine-free RPMI 1640 Medium (42401018, Gibco). HCT116 cells were cultured in glutamine-free McCoy's 5A Medium (PM150713, Procell, Wuhan, China). The cells were grown in a humidified incubator with 5% CO2 and 95% humidity at 37 °C.
6
Establishment and Maintenance of Oxaliplatin-Resistant Colorectal Cancer Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRC cell line SW480 was sourced from the American Type Culture Collection and was regularly maintained in our laboratory. SW480 and its derived oxaliplatin resistant (SW480-OXR) cells as well as knockout clones were cultured in the RPMI 1640 Medium (Gibco, cat. no. C11875500BT) supplemented with 10% fetal bovine serum (FBS) (BI, cat. no. 04-001-1ACS) and 1% penicillin and streptomycin (Gibco, cat. no. 15140122). SW480-OXR were established by treating the cells with an initial high dose (10 μM) of oxaliplatin (Selleck, cat. no. S1224) during the first week, followed by exposure to 5 μM oxaliplatin for 4 weeks after cell recovery. The resistant cells were maintained in a medium containing 1 μM oxaliplatin and restored to a complete medium without oxaliplatin 2 days before conducting the experiments.
7
Culturing Colon Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The colon cancer cell lines (HCT116, COLO320, T24, HT29, SW480, SW948 and SW1417) used in our study were purchased from American Type Culture Collection (ATCC). The colon cancer cell line COLO678 was obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ). Human HEK293T was purchased from ATCC. The culture medium for SW480 and HEK293T was RPMI-1640 medium (Invitrogen, Carlsbad, California, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah, USA), 100 U/mL Penicillium and 100 μg/mL Streptomycin. The culture medium for HCT116, COLO320, T24, HT29, SW480, SW948 and SW1417 were DMEM: F12 (1:1) medium (Thermo Fisher Scientific, Waltham, Massachusetts, USA) supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah, USA), 100 U/mL Penicillium and 100 μg/mL Streptomycin. Cells were maintained at 37 °C in a humidified atmosphere with 5% CO2. Replaced the culture medium 2–3 times every week.
8
Silencing LUCAT1 in Colorectal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines SW620 and SW480 were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). SW620 and SW480 cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA) supplied with 100 U/mL penicillin and 1 μg/mL streptomycin (Invitrogen), 10% fetal bovine serum (Invitrogen, shanghai, China) at 37°C with 5% CO2. The LUCAT1 and negative control siRNAs (Invitrogen, Carlsbad, CA) were transfected into SW620 and SW480 cells using RNAiMAX (Invitrogen) according to the manufacturer's instructions. Forty‐eight hours after transfection, the cells were harvested for RNA extraction. The LUCAT1 siRNA sequences are as follows: siRNA 1#, 5′‐CCCAUCAGAAGAUGUCAGAAGAUAA‐3′; siRNA 2#, 5′‐CAAGCUCUUGCAGUCAACAAGAACU‐3′.
9
Establishment of Colon Cancer Cell Lines Overexpressing KLK8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CRC cell lines RKO and SW480 were obtained from Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The RKO and SW480 cells were cultured in Dulbecco’s modified eagle medium (DMEM) (Invitrogen). All the media were supplemented with 10% foetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (Invitrogen). To establish cell lines stably overexpressing KLK8, a pcDNA3.1-KLK8 plasmid for KLK8 gene overexpression and its negative control were designed and synthesized by Shanghai Genechem Co. (Shanghai, China). RKO and SW480 cells were stably transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions, and the transfection efficiency was assessed using western blot assays.
10
Colorectal Cancer Cell Lines and Molecular Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HT29, SW480, SW620, LS174T, HCT116, C2BBel and HEK293T cell lines were purchased from ATCC (American Type Culture Collection, Manassas, VA, USA). HT29, SW480, HCT116 and C2BBel cells were maintained in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated foetal bovine serum (FBS, Invitrogen); LS174T and HEK293T were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% FBS, and SW480 cells were maintained in L15 medium (Invitrogen) supplemented with 10% FBS. The cells were incubated at 37 °C with 5% CO2. The following commercial antibodies were obtained from Cell Signaling (Danvers, MA, USA): rabbit monoclonal to PKM2; phospho-STAT3 (Y705); cleaved PARP; cleaved caspase-3; cyclin D1; p27Kip1; and mouse monoclonal to STAT3. The secondary antibodies used in the experiments were IRDye® 680 donkey anti-mouse IgG, IRDye® 800CW goat anti-rabbit IgG (LI-COR Biosciences, Lincoln, NE, USA), and Alexa Fluor 594 goat anti-rabbit IgG (Invitrogen). Gefitinib and STAT3 inhibitor V (Stattic) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!