Freestyle max reagent

For expression of most VNAs, a CHO cell host was employed. DNA encoding the VNAs was synthesized by Genscript with restriction sites compatible with insertion in frame into a mammalian expression vector based on pSecTag2. The sequences of encoded heterohexamer proteins are shown in Figure S1. Similar expression vectors were engineered for expression of heterodimeric VNAs encoding VHHs VA1/VA2 (VNA-BoNTA) or VB1/VB2 (VNA-BoNTB). Expression of the heterodimeric VNA-BoNTE containing VE1/VE2 is described as Trx/E/JLE-G6/JLE-E9/E in²⁴ and was produced and purified from E. coli. VNAs contained E-tags for detection. The mammalian expression plasmids were transfected into CHO-S cells in suspension cultures of serum-free FreeStyle™ CHO cell medium. Cells were transfected using FreeStyle™ MAX reagent (Invitrogen) according to the manufacturer’s recommendations and incubated under orbital shaking for three days. Conditioned medium was harvested under sterile conditions and stored at 4 °C. VHH and VNA expression levels were estimated by comparison to protein standards using BioRad Image Lab software. VNA-BoNTE was expressed in E. coli as previously reported²⁴ .

In order to verify whether Fc mutations affect the antigen-binding activity in vitro, two human PCSK9 proteins, wild type and its gain-of-function mutant D374Y were expressed and purified. First, Human PCSK9 cDNA was generated by RT-PCR from Hep G2 cells (ATCC, HB-8065), a human liver cancer cell line, and a His₆ tag was added to the N terminus of the protein. The gene was cloned into the mammalian expression vector pCEP4 (Invitrogen), and the gain-of-function mutation D374Y was then constructed by site-directed mutagenesis using the Fast Mutagenesis System (TransGen Biotech, Inc.) and confirmed by DNA sequencing. The PCSK9 WT and D374Y variant plasmids were transfected separately into human embryonic kidney cells 293F (Gibco) using FreeStyle^™ MAX Reagent (Invitrogen). Cells that stably expressed the PCSK9 proteins were selected by hygromycin B (Generay). Proteins were purified from culture supernatants using a Ni Sepharose excel column (GE Healthcare).

Large scale plasmid extraction was carried out by using QIAGEN ® Plasmid Maxi Kit (QIAGEN, USA) in order to obtain a concentrated (~1 mg/mL) target pcDNA: trp-2_1-472-cA expression plasmid for transfection. Cells were sub-cultured with fresh medium at 0.5–0.6 × 10⁶ cells/ml density a day prior to transfection, in order to obtain 1–1.5 × 10⁶ cells/ml confluency for transfection. The cell density was adjusted at 1 × 10⁶cells/ml and the culture medium was replaced with fresh culture medium. A total 480 ml culture was transfected by separately transfecting 16 replicates of 30 ml cell culture in 125 ml Erlenmeyer tissue culture flasks per constructed plasmids. The transfection was carried out by diluting 37.5 μl of FreeStyle™MAX reagent (Invitrogen, USA) and 37.5 μg plasmid DNA separately into 0.6 ml of Opti-PRO™ Serum Free Medium, SFM (Invitrogen, USA), and then the two solutions weremixed together. The resulting 1.2 ml DNA-FreeStyle™MAX reagent mixture was incubated at room temperature for 10 min. The mixture was then added drop wise into 1 × 10⁶ cells/ml cell suspension while gently swirling the flask and transfected cells were subsequently shaken at 135 rpm for three days in a CO₂ incubator at 37 °C. Cells were harvested on the third day post-transfection for protein analysis by SDS-PAGE and Western Blot.

Anti C5 scFv antibody (6 (link)) was cloned, using BssH2 and NheI restriction sites, into pMB-SV5 vector (16 (link)) containing human IgG1 Fc region to produce the scFv-Fc molecule called Mubodina (ADIENNE Pharma & Biotech). Ergidina was generated by replacing SV5 tag with the peptide RGD-4C (17 (link)). To this end, Mubodina was amplified with the following oligos pMBsense CTGCTTACTGGCTTATCG and pMB-RGD-anti GGTTTAAGCTTTTAGCCGCAGAAACAATCTCCTCGGCAGTCGCAGGCGCCTTTACCCGGGGACAGGGAGAG. The first oligo anneals on the vector pMB at the 5′ while the second anneals at the end of human CH3 region and introduce the RGD-4C sequence and the Hind III restriction site sequence. After PCR amplification, the fragments were cut with XbaI an Hind III restriction sites and cloned into pMB-SV5 vector. Finally, both Moubodina and Ergidina were subcloned into pUCOE (18 (link)) vector. All clones obtained were confirmed by sequencing.
Purified plasmid DNA was transfected with freestyle max reagent (Invitrogen) in CHO-S cells according to a standard protocol and the cells were grown in Pro-CHO 5 (Lonza). The recombinant scFv-Fcs were purified from cell-conditioned medium loaded on Protein A column and eluted with citric acid 0.1M pH 3. Fractions containing the recombinant proteins were selected by ELISA (6 (link)) and checked for purity by SDS-PAGE (19 (link)).

In CHO-S cells, the tethered R-eCG expression vector was transfected into CHO-S cells using the FreeStyle MAX reagent (Invitrogen; Carlsbad, CA, USA) transfection method, in accordance with manufacturer’s instructions. Flasks were placed on an orbital shaking platform, rotating at 120–135 rpm at 37 °C in a humidified atmosphere of 8% CO₂ in air. On transfection, the cell density was approximately 1.2–1.5 × 10⁶ cells/mL. The plasmid DNA (260 μg) and a FreeStyle™ MAX Reagent complexes were gradually added to 200 mL of medium containing cells. Finally, culture media were sampled on day 9 after transfection and centrifuged to eliminate cell debris. The supernatant was sampled and stored at − 20 °C until the assay. The samples were concentrated using a Centricon filter or by freeze-drying and mixed with PBS.