Ez magna chip a kit
The EZ-Magna ChIP A kit is a laboratory product designed to facilitate chromatin immunoprecipitation (ChIP) experiments. It provides the necessary reagents and protocols to isolate and analyze DNA-protein complexes from cells or tissues.
Lab products found in correlation
25 protocols using ez magna chip a kit
Chromatin Immunoprecipitation for Transcription Factor Binding
PPARα Binding Site Analysis in Liver Tissue
ChIP Assay for CEBPB Binding
ChIP-qPCR Assay for NIS Promoter Analysis
The Schematic Diagram of the Primer Locations Relative to the NIS Gene Promoter and Gene Body
The amplicon size is 323 bp (−629/−370).
qPCR Primer of the NIS Promoter for ChIP Studies
Primer Sequences (5′-3′) | Amplicon Size (bp) and Nucleotide Number | |
---|---|---|
NIS promoter | forward GAGTGCTGAAGCAGGCTGTGC | 323 (−692/−370) |
reverse GGGAGCAGCTCGTGATTGTGG |
ChIP-qPCR Analysis of NFATC3 Binding
GATA3 Binding on vWF Promoter
ChIP Assay with ETV6 Knockdown
Chromatin Immunoprecipitation (ChIP) Assay Protocol
Chromatin Immunoprecipitation and Quantitative PCR
ChIP Assays for Transcription Factor Binding
ZNF32 gene promoters, −1409ACA GCC GGT CTT GAC CTT AAC−1388 (forward) and −1213GGG GTG TTG CAC AGC TAA GTC−1193 (reverse); −185GCT GTG AGT CTC CGG ATT ACC AG−163 (forward) and +75CGG CCT CAC TCA CCG CA+91 (reverse); C1QBP gene promoters, −1133CAC AAG CAT GAG TTC CGA GCC−1113 (forward) and −966GTT GGG ATT GAA TTG GAG GAC AC−944 (reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!