Puc19

Escherichia coli (E. coli) DH5α and pUC19 (TaKaRa, Dalian, China) were used for the construction of random mutagenesis libraries. The E. coli strain BL21 (DE3) and the pET-21b (+) plasmid (Novagen, Madison, WI, USA) was used for protein expression. Restriction endonucleases, DNA polymerase and T4 DNA ligase were purchased from Thermo Fisher Scientific (Hudson, NH, USA). N-octanoyl-DL-homoserine lactone (C₈-HSL) and p-nitrophenyl acetate were purchased from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals and reagents were of analytical grade and purchased from commercial sources, unless indicated otherwise.

Acetic acid bacteria (AAB) used in this study are listed in Table S2, and were obtained from culture collections including JCM, NBRC, IAM, NRIC, ATCC, and DSM. Escherichia coli HST08 for general cloning host, pUC19 as a cloning vector, and pMD19 as a TA cloning vector were purchased from Takara Bio Inc. (Shiga, Japan). An ampicillin-resistant pMV24 plasmid was used as an Acetobacter spp.-E. coli shuttle vector^{25 (link)}. Oligonucleotide primers used for PCR are summarized in Table S5. AABs were grown at 30 °C in YPG medium [containing (per liter): yeast extract, 5 g; hipolypeptone, 3 g; glucose, 30 g]. E. coli was grown in Luria–Bertani (LB) medium. For preparation of solid medium, 1.5% agar was added. To select transformants of E. coli and Acetobacter spp., ampicillin was added at 40  $\mathrm{\mu }$ g/mL. All chemicals and enzymes used were obtained from Wako Pure Chemical (Osaka, Japan) and Takara Bio Inc., respectively, unless otherwise indicated.

Three plasmid DNA (pUC19, pHSG298, and pHSG396) were purchased from Takara Biotechnology (China) Co., Ltd. The plasmids were suspended in the solution of 10 mM Tris–HCl (pH 8.0) and 1 mM EDTA at a concentration of 0.5 μg μl^-1. pUC19 (2686 bp), pHSG298 (2675 bp), and pHSG396 (2238 bp) carry ampicillin, kanamycin, and chloramphenicol resistance genes, respectively (Supplementary Table S1). NaCl, tryptone, and yeast extract in biotechnology grade were purchased from Oxoid (England) Co, Ltd. Agar powder, ampicillin sodium salt, kanamycin, and chloramphenicol were purchased from Solarbio Science and Technology (China) Co., Ltd. CaCl₂⋅2H₂O and propidium iodide were purchased from Sigma–Aldrich (St. Louis, MO, United States).

Escherichia coli CVCC196, E. coli CVCC216, E. coli CVCC220, E. coli CVCC223, E. coli CVCC224, E. coli CVCC1500, E. coli CVCC1502, E. coli CVCC1513, E. coli CVCC1514, E. coli CVCC1519, E. coli CVCC1496, E. coli CVCC2943, and E. coli Ae1 were obtained from the China Institute of Veterinary Drug Control (IVDC). E. coli ATCC25922 was purchased from the American Type Culture Collection (ATCC). E. coli DH5α was purchased from BestBio (Shanghai, China). Supercoiled plasmid pBR322 and pUC-19 were purchased from Takara (Dalian, China).

KO was performed as recently described¹⁸, ²⁵, ³³ using pX330 and pCAG‐EGxxFP³⁴ purchased from Addgene. In CRISPR/Cas9‐based gene disruption, guide (g) RNA sequences (5’‐AGCTGTGGCAGCGTCAACAG‐3′) corresponding to the MET gene (394–413 bp from the initiation ATG site), (5’‐GAGGGCGAACGACGCTCTGC‐3′) HER3 gene (3–22 bp from the initiation ATG site), and FOXM1(5’‐CCGTCGGCCACTGATTCTCA‐3′) gene (15–33 bp from the initiation ATG site) were designed using CRISPR direct (https://crispr.dbcls.jp/). SW1116 cells were used to generate HER3 and/or MET and the FOXM1‐KO cell line using the pX330 (Addgene) and pCAG‐EG × ×FP (Addgene) CRISPR/Cas9 vectors. The gene‐specific region of gRNA sequences was designed by the CRISPR design tool from CRISPR direct (https:/crispr.dbcls.jp/). Single clones were picked up and the KO efficiency was assessed by WB and FCM. Cells were seeded onto 35‐mm dishes (BD BioCoat, Franklin Lakes, NJ, USA) in 1 mL of RD medium, and plasmid DNA (5 μg) was introduced into cells of approximately 80% confluency using Xfect transfection reagent (Takara Bio Inc.). The co‐transfection of pX330 and pUC19 (#3219, Takara Bio) containing the puromycin‐resistant gene was also performed, and cells were cultured with puromycin (Invitrogen, 2 μg/mL) for 10 days.