Sodium carboxymethylcellulose

Escherichia coli DH5α, P. pastoris X-33 were used as host for plasmid propagation and heterologous gene expression. Wheat arabinoxylan was purchased from Megazyme International (Irish, Ireland). Beechwood xylan was purchased from Sigma-Aldrich (St. Louis, MO, United States). Oat pelt xylan, pectin, and sodium carboxymethyl cellulose were purchased from Solarbio (Bejing, China). The restriction endonucleases were purchased from Thermo Fisher Scientific (Shanghai, China). Wholewheat flour with 57% water absorption, 11.00% protein, and 12.10% moisture was purchased from Saixin Flour Industry Co. Ltd. (Bayannur, China). The buffered methanol-complex and glycerol-complex medium (BMMY/BMGY), yeast extract peptone dextrose agar medium (YPD), and low salt Luria Bertani media (LBL) were prepared according to the yeast fermentation processing guidelines (Invitrogen). Unless otherwise stated, other reagents were analytical pure reagents, purchased from China.

CTD (purity above 99%, Sigma, USA); Sodium carboxymethyl cellulose (Solarbio, China); PBS (Solarbio, China); Aspartate aminotransferase kit (AST), Alanine transferase kit (ALT), Alkaline phosphatase kit (ALP), Lactate dehydrogenase kit (LDH), Triglyceride kit (TG), Cholesterol kit (TC), High-density lipoprotein kit (HDL-C) and Low-density lipoprotein kit (LDL-C) Boxes were purchased from Nanjing Jiancheng Co., Ltd.

Sesamin (Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China; CAS, 607-80-7, purity 98%), saline solution (vehicle, Beijing Solarbio Biotechnology Co., Ltd., Beijing, China), and sodium carboxymethyl cellulose (Beijing Solarbio Science and Technology Co., Ltd., Beijing, China; CAS, 9004-32-4) were used. All mice were randomly divided into five groups (twenty per group) after acclimatization for 4 days: the control group (standard chow plus vehicle via gavage), the CTX-treated group (standard chow plus 120 mg/kg/week cyclophosphamide dissolved in normal saline via gavage), and the CTX plus Sesamin (50 mg/kg, 100 mg/kg, and 200 mg/kg Sesamin dissolved in 0.5% CMC with chow plus cyclophosphamide via gavage) group.

The recombinant virus LSDV-eGFP was constructed by inserting the eGFP-ORF into the region between LSDV049 and LSDV050 in the LSDV/FJ2021 strain³⁸ , under the control of the late promoter p11 (TTTCATTTTGTTTTTTTCTATGCTATAA). Plasmid transfection and virus infection were carried out using BHK cells. After 48 hours, the virus was harvested, and the recombinant virus was purified using MDBK cells. The purification process involved using a DMEM medium(Solarbio, cat#11995) containing 0.5% carboxymethylcellulose sodium(Solarbio, cat#C8621) and 2.5% Donor Equine Serum(Biological Industries, cat#04-004-1 A).

Feed suspensions were stirred and spray-dried in a co-current laboratory spray dryer (SD-1000, Eyela, Tokyo, Japan). Volumetric airflow was 0.48–0.51 m³/min and atomizing pressure was 130 kPa and the feed rate was 400–600 mL/h [9 (link)]. The inlet temperature was set to 120 °C and the outlet temperature was stabilized at 60 °C by changing the feed rate.
Sampling was performed as described previously [12 (link)]. Briefly, samples were collected with a pre-cooled sampling device containing magnets and refrigerants, sodium polyacrylate and carboxymethylcellulose sodium (Solarbio, Beijing, China), to cool the sample. A sample of 151 ± 27 mg was taken for measurement of water content after drying. The sampling device was pre-loaded with 2 mL sterile water to rehydrate bacteria for the measurement of cell survival. Four sampling points were selected at 10 cm intervals (10, 20, 30 and 40 cm) inside the drying tower (tower height: 0.5 m). The 0 cm samples were controls (feed liquid suspension), and the 50 cm samples were powder in the cyclone chamber.