The class A β-lactamase gene blaHER–9 was PCR amplified by PCR and sequenced with primers HER-9F and HER-9R, designed using the whole sequence of the WEB-2 isolate (Table 1 ). The obtained amplicon was cloned into the pCR-Blunt II-TOPO plasmid (Invitrogen). The recombinant pTOPO-HER-9 plasmid was electroporated into the E. coli TOP10, and the resulting recombinant E. coli TOP10 p(HER-9) was selected on ampicillin 100 mg/L containing trypticase soy agar (TSA) plates.
Pcr blunt 2 topo plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PCR-Blunt II-TOPO plasmid is a laboratory tool used for the direct cloning of blunt-ended PCR products. It provides a quick and efficient method for the insertion of PCR amplicons into a plasmid vector without the need for ligation or restriction enzyme digestion.
Automatically generated - may contain errors
Lab products found in correlation
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Pcr clean up gel extraction kit, by Macherey-Nagel (1 mentions)
Tempase hot start dna polymerase, by Ampliqon (1 mentions)
Luc2cp hygro, by Promega (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Smarter race kit, by Takara Bio (1 mentions)
Kapa mouse genotyping kit, by Roche (1 mentions)
Crl 4000, by American Type Culture Collection (1 mentions)
8 protocols using pcr blunt 2 topo plasmid
1
Cloning and Sequencing of bla HER-9 Gene
2
Construction of Kanamycin-Resistant A. baumannii Complementation Plasmid
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A kanamycin resistance marker was PCR-amplified from the pCR-BluntII-TOPO plasmid (from Invitrogen) using the primers listed in Table S1 . The resulting product was inserted in the PstI site of the pWH1266 plasmid (Hunger et al., 1990 (link)), obtaining the pWH1266-Km plasmid. To complement the Δ0114 strain, the A1S_0114 wild type allele was PCR-amplified from 17978 genomic DNA using the primers listed in Table S1 . The resulting product was cloned into the EcoRV and BamHI restriction sites of the pWH1266-Km plasmid (Table 1 ). The parental A1S_0114 allele was cloned as a BamHI-EcoRV amplicon into the pWH1266-Km under the control of the tetracycline resistance gene promoter using the primers listed in Table S1 . The complementing plasmid pWH1266-Km-0114 (Table 1 ) was transformed into Δ0114 cells by electroporation (Rumbo-Feal et al., 2013 (link)). Transformants were selected on Km-containing plates and the presence of pWH1266-Km-0114 was confirmed by PCR using primers listed in Table S1 . Δ0114 cells harboring empty pWH1266-Km were used as a negative control.
3
var2csa Gene Region Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The region of the var2csa gene (PFL0030c) covering the NTS-ID2a fragment, nucleotide positions 1–3100 (3100 bp) was amplified from the cDNA of pregnant women isolates, using the high fidelity Fusion Taq Polymerase (New England Biolabs). Primers Fw 5’-ATGGATAAATCAAGTATTGCT-3’ and Rv 5’-GAACAGTGGAACAAAGAAATAC-3’ were used under the cycling conditions: 94°C for 1 min, followed by 35 cycles of 94°C for 30 s, 50°C for 30 s and 68°C for 3 min 40 s, with a final extension at 68°C for 10 min. The PCR products were subjected to electrophoresis and purified using the "PCR clean-up, Gel extraction" kit (Macherey-Nagel). Amplicons were ligated into pCR™-Blunt II-TOPO plasmid (Invitrogen) and transformed into One Shot competent bacteria using the TOPO cloning kit—Zero Blunt (Invitrogen), as recommended by the manufacturer. All colonies were analyzed by PCR using the TEMPase Hot Start DNA polymerase (Ampliqon) and the flanking universal primers M13F / M13R. Ten clones were selected per sample. DNA was sequenced from selected clones at GATC biotech (Cologne, Germany).
4
Cloning and Mutagenesis of GILZ Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gilz promoter was PCR-amplified from the genomic DNA of primary human airway epithelial cells (Lonza Walkersville, Inc., Walkersville, MA, USA) using the primers (Long-GILZp-F and GILZp-R). The amplicon was cloned into pCR™-Blunt II-TOPO® plasmid (Invitrogen), and the primary sequence was verified by DNA sequencing. Then, the obtained 1.94-Kb promoter was excised with KpnI/HindIII and subcloned into the promoter-less pGL.4.16[luc2CP/Hygro] plasmid (Promega, Madison, WI, USA), resulting in pGL.4.16-wtGILZ-2p-[luc2CP/Hygro] in which the GILZ promoter drives the expression of the rapid-response firefly luciferase (Fluc) gene. The cloned promoter contains five GREs. To remove GRE3-5, the region (−1,560 to −1,884) was deleted using the primers (Short-GILZp-F and GILZp-R). To achieve site-specific mutagenesis of the GRE1 and GRE2 core sequences, QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) was used, as instructed by the manufacturer. Synthetic oligonucleotide primers (Mut-GRE1-F, Mut-GRE1-R, Mut-GRE2-F, and Mut-GRE2-R) were used to introduce mutations. All the plasmids with mutagenesis were verified by DNA sequencing.
5
Amplifying KPC Variants from E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-cell DNAs of E. coli isolates producing KPC-2, KPC-3, and KPC-28 were extracted using the QIAamp DNA minikit (Qiagen, Courtaboeuf, France) and were then used as a template to amplify the bla KPC-2-like genes. The gene encoded for KPC-14 was obtained by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit, Agilent Technologies), using the primer KPC-Y274H (5'-CTAACAAGGATGACAAGCACAGCGAGGCCGTCATC-3') and the plasmid pTOPObla KPC-28 as a template. The PCR, using the primers Kpc-rbs (5'-CTCCACCTTCAAACAAGGAAT-3') and Kpc-rev (5'-ATCTGCAGAATTCGCCCTTCGCCATCGTCAGTGCTCTAC-3'), was able to amplify bla KPC-3 and bla KPC-28 genes. The amplicons obtained were then cloned into the pCR-Blunt II-Topo plasmid (Invitrogen) downstream from the pLac promoter, in the same orientation for the phenotypic studies. The recombinant pTOPO-KPC-plasmids were electroporated into the E. coli TOP10 strain. For protein production, the sequences without the peptide signal of the bla KPC-2 , bla KPC-3 , bla KPC-14 and bla KPC-28 genes were obtained by PCR amplification using primers NdeI-KPC-2 30-293 (5'-CATATGGCGGAACCATTCGCTAAC-3') and KPC-2
6
RACE Protocol for Ovarian Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RACE was performed using the Clontech protocol and a SMARTer RACE kit (Clontech, Mountain View, CA, USA). RACE‐ready cDNA was performed using the Clontech reagents and RNA collected from ovaries dissected 48 hPBM. RACE reactions were performed using Phusion High Fidelity Master Mix from New England Biosystems (Beverly, MA, USA). Nested RACE reactions were performed with touchdown PCR cycles on separate preparations of 5′‐ and 3′‐end cDNA templates as described in the Clontech protocol. Primers were designed using Prime 3 software (Table S1). RACE and nested RACE products were run on agarose gels, and fragments extracted and cloned into the pCR‐Blunt II TOPO plasmid (ThermoFisher Scientific, Grand Island, NY, USA). Plasmids were amplified in chemically competent TOP10 Escherichia coli and analysed by sequencing using M13 forward and reverse primers.
7
CRISPR/Cas9 Genome Editing of hTERT RPE-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CDG and CDDG lines were generated by CRISPR/Cas9 genome editing of hTERT RPE1 (ATCC, CRL 4000TM) at the Columbia Stem Cell Core Facility. Promoter (U6) and gRNA scaffolds were synthesized by IDT and cloned into the pCR-Blunt II-TOPO plasmid (ThermoFisher Scientific, cat. K280002). Nucleofector (Lonza) was employed to introduce gRNA and Cas9-GFP plasmids into hTERT RPE-1 cells. After nucleofection, single colonies were manually picked into either 96-well plates or 10 cm dishes, incubated for ten days to reach confluency (96-well plate) or visible colonies (10 cm dish). For each colony, DNA was extracted by the KAPA Mouse Genotyping Kit (KAPA Biosystems) and genotyped by Sanger sequencing.
Guide RNA scaffold and termination signal: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.
gRNA NGLY1: GGTGATTGCCAGAAGAACTAAGG, PMM2: GAATTCAATGAAAGTACCCCTGG, DPAGT1: CATGATCTTCCTGGGCTTTGCGG.
Guide RNA scaffold and termination signal: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.
gRNA NGLY1: GGTGATTGCCAGAAGAACTAAGG, PMM2: GAATTCAATGAAAGTACCCCTGG, DPAGT1: CATGATCTTCCTGGGCTTTGCGG.
8
Constructing a SoxR-controlled lacZ Reporter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The E. coli K-12 genomic region that constitutes the soxR protein and the divergent overlapping PsoxR and PsoxS promoters was inserted into a pCR-BluntII-TOPO plasmid (Thermo Fisher Scientific). This construct and the plasmid pFZY1 were digested with BamHI and HindIII and ligated such that the lacZ gene in pFZY1 was downstream of the PsoxS promoter. pTG1 allowed for SoxR-mediated expression of β-galactosidase.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!