Luna universal probe qpcr master mix

Primary bronchial epithelial cells were cultured on collagen-coated 24 well plates and transfected employing Interferin (Polyplus) with an over-expression vector for Zfp36l1 (courtesy of Prof Mayr, Memorial Sloan Kettering Cancer Center, United States) and siRNAs against ZFP36L2. RNA was extracted using TRIzol following manufacturer’s instructions. RT was performed employing H-minus RT (ThermoFisher Scientific) and qPCR performed using Luna Universal Probe qPCR Master Mix (New England Biolabs) using TaqMan primers (ThermoFisher Scientific).

Quantitative real-time PCR (qPCR) was performed to determine the relative amounts of both N. gonorrhoeae and human DNA in the DNA extracts from the initial laboratory optimization methods. qPCR was performed on a Stratagene MX3005P qPCR system (Agilent Technologies, Santa Clara, CA, USA) using Luna universal probe qPCR master mix (New England BioLabs, Ipswich, MA, USA). Primers and probes were used to target the β-actin gene for human DNA detection (18 (link)) and the porA pseudogene for detection of N. gonorrhoeae (papTM) (19 (link)). Reactions were performed in 20 μl, with 2 μl of template DNA, 0.4 μM each primer, and 0.2 μM of the probe. Cycling conditions were an initial denaturation at 95°C for 1 min, followed by 40 cycles of 95°C denaturation for 15 s, and 60°C extension for 30 s. N. gonorrhoeae genomic DNA, extracted from cultures of WHO F, WHO V, and WHO X reference strains, was diluted to 100,000 genome copies per μl then serially diluted to 10 genome copies per μl, and used to create copy number standard curves. Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve. Negative controls, replacing template DNA with water, were also performed. All qPCR assays were performed in triplicate, and the mean value was used in analyses.

Total RNA was extracted by using Purelink RNA Mini kit (Invitrogen, Paisley, UK) from LS174T cells, upon 6 h treatment with test items (100 nM ST7612AA1, 250 nM ST8176AA1 or trastuzumab, or 10 μM GANT58, a reference Hh inhibitor) in serum-free medium (Sigma- Aldrich), followed by incubation for additional 18 h with 100 nM Hh agonist SAG (Sigma-Aldrich). Cells only grown in serum-free medium were used as unstimulated (reference control) cells. RNA was then retrotranscribed using the SuperScript IV VILO Mastermix (Invitrogen, Paisley, UK), according to the manufacturer's instructions. Real time quantitative PCR analysis was performed using the Luna® Universal Probe qPCR Master Mix (New England Biolabs, Ipswich, MA, USA) and the following TaqMan Gene Expression Assays (Applied biosystems, Foster City, CA): Hs00171790_m1 [GLI-1], Hs01119974_m1 [GLI-2], Hs00181117_m1 [PTCH1], Hs00170665_m1 [SMO], Hs00960520_m1 [SUFU] and Hs00939627_m1 [for the housekeeping gene GUSB]. The 7900HT Sequence Detection System instrument and software (Applied Biosystems) were used to quantify the mRNA levels of the target genes, according to a six-point serial standard curve generated for each gene. Results were ultimately expressed, after normalization to the housekeeping gene GUSB, as relative expression as compared to not stimulated cells.

For quantification of TPA strains during single in vitro cultivation, qPCR detection was designed for the polA gene (TP0105; product size 129 bp) using two primers (5’–GAGTGTGCAGTCCGCTATGC–3’ and 5’–AGGCAAAAGCGGCATTTCTA–3’) and one probe qPCR_polA_probe (5’–FAM-TCCGCTTGGAAACAGCAGGATTG-BHQ–3’) [17 (link)]. qPCR was performed using the Azure Cielo Real-Time PCR System (Azure Biosystems). Each PCR reaction (20 μl) contained Luna Universal Probe qPCR Master Mix (10 μl, New England Biolabs), primers (0.08 μl each, final conc. 400 nM), FAM-labeled probe (0.04 μl, final conc. 200 nM), template DNA (i.e., 5 μl of treponemal in vitro culture), and nuclease-free water (4.8 μl). PCR cycling conditions were 95°C (10 min), followed by 40 cycles at 95°C (10 s), and 60°C (30 s). A standard curve for TPA DNA was constructed using 10-fold serial dilutions (i.e., 10⁰–10⁶ copies/μl) of the pCR2.1-TOPO vector (Invitrogen) containing the cloned polA fragment.

Total RNA was extracted from the liver tissue using a High Pure RNA Isolation Kit (Roche, Mannheim, Germany). Aliquots of total RNA (2 µg) were transformed into cDNA using a cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). The cDNA subsequently underwent amplification for quantitative qPCR using Luna Universal Probe qPCR Master Mix (New England Biolabs, Beverly, MA, USA) and target-specific probe primer (Applied Biosystems, Foster City, CA, USA) for COL1A1, TGF-β, and IL-10. Relative expression was calculated using comparative ∆∆Ct values.

PVs were quantified by RT-qPCR, using primers and a probe that target the CMV promoter. Culture supernatants containing PVs were treated with 100 μg/ml RNase A for 1 h at 37 °C to degrade RNAs that are not packaged inside the virion, and RNA was extracted with Trizol and GlycoBlue coprecipitant and digested for 30 min at 37 °C with DNase I at 1 IU per 1 μg extracted RNA. DNase I was inactivated by incubating for 10 min at 65 °C with EDTA added to final 5 mM. DNase-treated RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4374966). qPCR was performed, using Luna Universal Probe qPCR Master Mix (New England Biolabs, M3004E) with the known quantity of pQCXIX vector to generate standard curves and data were collected with CFX Manager 3.1 (Bio-Rad). Primers and a probe were synthesized at Integrated DNA Technologies. Sense primer: 5ʹ-TCACGGGGATTTCCAAGTCTC-3ʹ, anti-sense primer: 5ʹ-AATGGGGCGGAGTTGTTACGAC-3ʹ, probe: 5ʹ-FAM-AAACAAACT-(ZEN)-CCCATTGACGTCA-IBFQ-3ʹ.