The largest database of trusted experimental protocols

Jetpei macrophage transfection reagent

Manufactured by Polyplus Transfection
Sourced in France

JetPEI®- Macrophage is a transfection reagent optimized for the efficient delivery of nucleic acids into macrophage cells. It is a cationic polymer-based solution designed to facilitate the uptake of DNA, RNA, or other genetic material into target cells.

Automatically generated - may contain errors

3 protocols using jetpei macrophage transfection reagent

1

Transfection and Luciferase Assay for Estrogen Receptor Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
After plating and differentiating THP-1 cells as described above, cells were transiently transfected with hERα-pSG5 (kindly provided by P. Chambon, Institut Clinique de la Souris, Illkirch Cedex, France), or with pcDNA flag ERα wt or pcDNA flag ERα C447A (kindly provided by F. Acconcia, University Roma Tre, Rome, Italy), and with pERE-TkGL3 (kindly provided by P.J. Kushner, Metabolic Research Unit and Diabetes Center, University of California, San Francisco, USA), and pRL-CMV (Promega), a renilla luciferase vector. Transfection was performed with jetPEI®- Macrophage transfection reagent (Polyplus-transfection) according to the manufacturer’s instructions. Prior to stimulation, cells were starved for a maximum of 10 h. After harvesting, cell lysates were used to measure luciferase activity with the dual-luciferase reporter assay system (Promega).
+ Open protocol
+ Expand
2

Nrf2 Decoy Modulates Microglial Phagocytosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The double stranded oligonucleotide ARE decoy (ctaatggtgacaaagcaacttt; containing Nrf2 core binding sequence) or mutant-decoy (cgactgccttcaaaataacttt) in JetPEI-Macrophage transfection reagent (Polyplus Transfection Inc.) was added to microglia in culture for 24h at 2.5 μM. After 24h incubation, the microglial cells were used for phagocytosis assay.
+ Open protocol
+ Expand
3

Silencing PHLDA1 and Tollip in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNA (siRNA) for PHLDA1 and Tollip were designed and synthesized by GenePharma (Shanghai, China). The above siRNA fragments were transfected into RAW264.7, BMDM, or L-929 cells using jetPEI®-Macrophage transfection reagent (Polyplus Transfection, Illkirch, France) or Lipofectamine RNAiMAX according to the manuals of the manufacturer. The above cells were further analyzed at 72 h after transfection. PHLDA1 and Tollip siRNA sequences are listed in Supplementary Table 2. Plasmids were transfected into RAW264.7, BMDM, L-929, or 293T cells using Lipofectamine 2000, jetPEI®-Macrophage transfection reagent, or EZ Cell Transfection Reagent II according to the manuals of the manufacturer. The above cells were further analyzed at 48 h after transfection.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!