We used Trizol reagent to extract total RNA from frozen heart samples. The total RNA was purified using RNeasy columns (Qiagen, Valencia, CA, USA). After that, DNAase-treated RNA was reverse transcribed using PrimeScript1 RT reagent Kit (TaKaRa, Dalian, China) with Bulge-Loop™ miRNA. The quantitation was performed with SYBR Premix Ex TaqTM II (Tli RNaseH Plus, TaKaRa). Expression of the target genes was measured in triplicate and then normalized to β-actin.
Primescript1 rt reagent kit
Manufactured by Takara Bio
Sourced in China, Japan
The PrimeScript1 RT reagent kit is a tool designed for reverse transcription, a crucial step in the process of converting RNA into complementary DNA (cDNA) for various downstream applications in molecular biology and genomics. The kit contains the necessary reagents, including reverse transcriptase enzyme, primers, and buffers, to facilitate the efficient and reliable conversion of RNA into cDNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Sybr premix ex taqtm 2 tli rnaseh plus, by Takara Bio (1 mentions)
Rneasy column, by Qiagen (1 mentions)
Nanodrop nd 1000 spectrophotometer, by Agilent Technologies (1 mentions)
Sybr premix ex taqtm kit, by Takara Bio (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primer sequences, by Takara Bio (1 mentions)
Mx3005p, by Takara Bio (1 mentions)
Sybr1 premix ex taqtm 2, by Takara Bio (1 mentions)
Sybr1 green pcr master mix, by Takara Bio (1 mentions)
Taqman microrna assay kit, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500, by Thermo Fisher Scientific (1 mentions)
6 protocols using primescript1 rt reagent kit
1
Cardiac miRNA Expression Analysis
2
Quantifying GMPPB mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HEK 293T cells transfected with relative plasmids using a standard method with TRIZOL Reagent (Invitrogen), and reverse‐transcribed using the PrimeScript1 RT reagent Kit (Takara) according to the manufacture's instruction. To determine whether the GMPPB variant affects the mRNA level, we designed three pairs of primers (Table S1 ), namely 2F/3R (at exon 2 and 3, respectively), 5F/5R (at exon 5), and 9F/9R (at exon 9) to verify the amount of GMPPB mRNA.
3
Quantifying Gene Expression in Lymphoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from transfected and non-transfected Granta-519 and Z138 cells was extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. Total RNA (2 μg) was reverse transcribed to cDNA with the PrimeScript1 RT reagent kit (TaKaRa, Shanghai, China). Real-time quantitative polymerase chain reaction (PCR) was performed using SYBR Green PCR MasterMix according to the manufacturer's instructions. The following forward and reverse primers used: 5′-CTCCCCCACCACCCAAAT-3′ and 5′-TTGTCACCTGCTACTGAAG-ATGCT-3′ (TOSO) and 5′-GAAGGTGAAGGTCGGAGTC-3′ and 5′-GAAGAT-GGTGATGGGATTTC-3′ (GAPDH). Relative expression levels were analyzed by the 2-ΔΔCt method.
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells and tissues using a TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. RNA quality and concentration were measured using NanoDrop ND-1000 Spectrophotometer (Agilent, Santa Clara, CA, USA). Total RNA was reverse-transcribed using a PrimeScript1 RT Reagent Kit (TaKaRa, Kusatsu, Japan), and the SYBR Premix Ex TaqTM Kit (TaKaRa, Kusatsu, Japan) was then used to determine gene expression with gene-specific primers, according to the manufacturer’s instructions. PCR reactions were performed on the StepOnePlusTM Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and the cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The PCR products were identified using a melting-curve analysis. Relative fold changes were calculated using the 2−△△Ct method. The sequences of primers are shown in Supplementary Table S1 .
5
Quantifying SDF1 and CXCR4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis of SDF1 and CXCR4 mRNA expression, total RNA from FA7DOWN/PA7UP, FSHUS/PNCEV and original F/P cells as well as normal liver cells in vitro and in vivo were extracted using Trizol reagent (Invitrogen, USA). Reverse transcription of purified RNA was performed using the PrimeScript1 RT reagent kit (Takara, Japan). Quantification of gene transcripts was performed by qRT-PCR (Fluorescence real-time quantitative PCR meter MX3005P, USA) using SYBR1 Premix Ex TaqTM II (Takara, Japan), and the levels were normalized to GAPDH as the internal control. Primer sequences (Takara, Japan) for SDF1, CXCR4 and GAPDH are listed in Table 2 . MXP software was used to analyze the results. Differences in mRNA expression were calculated according to the△△Ct method and displayed as 2(—△△Ct).
Primer sequences for SDF1, CXCR4 and GAPDH
| Sequence | Forward primer (5′ → 3′) | Reverse (5′ → 3′) |
|---|---|---|
| Gene name | ||
| SDF1 | CCTGTGTGTCATGCCCTCTT | AGTCCAGCCTGCTATCCTCA |
| CXCR4 | GTCAACCTCTAGAGCAGCGT | CTATCGGGGTAAAGGCGGTC |
| GAPDH | AAATGGTGAAGGTCGGTGTGAAC | CAACAATCTCCACTTTGCCACTG |
6
Quantitative Analysis of Neural Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs of cells were extracted using Trizol Reagent (Invitrogen) according to the manufacturer's instruction. Then the RNA samples were used for reverse transcription to get the first strand cDNA by using the PrimeScript1 RT reagent kit (TaKaRa Bio, Dalian, China). The expressions of RhoA and ROCK1 mRNA and neurogenic markers NSE and β III tubulin were quantified using gene specific primers with SYBR1 Green PCRMaster Mix (TaKaRa Bio). GAPDH was used as the endogenous control gene. MiR-142-5p expression was detected using TaqMan MicroRNA Assay Kit (Applied Biosystems), with U6 snRNA used as the endogenous control. All qRT-PCR analysis was performed using an ABI Prism 7500 (Applied Biosystems). The results of qRT-PCR analysis were presented using 2 -ΔΔ CT method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!