Prl cmv renilla luciferase expression vector

HEK-293T cells were plated at density of 350.000 cells per 35-mm-diameter culture dish and processed 42 h after standard calcium phosphate transfection. Cells were transfected with 200 ng of the reporter constructs and 200 or 400 ng of pcDNA3HA-HMGA1a vector. In order to normalize for transfection efficiencies, 10 ng of pRL-CMV Renilla luciferase expression vector (Promega) were transfected into the cells. The reporter constructs were the following: pGL4-phPLAU (From −1374 to +29 relative to the predominant transcription start site) and pGL4-phSERPINE1 (PAI-1) (From −1410 to +39) (DNA Bank RIKEN BioResource Center). The assays were performed with dual-luciferase reporter assay system (Promega) according to the manufacturer’s instruction. Western blot analyses were performed on samples normalized for transfection efficiencies.

HEK-293 cells were plated at density of 350,000 cells per 35-mm-diameter culture dish and processed 46.5 h after standard calcium phosphate transfection. Cells were transfected with 500 ng of the reporter construct, 1 μg of pcDNA3HA or pcDNA3HA-HMGA1a, and 50 ng of pRL-CMV Renilla luciferase expression vector (Promega) to normalize for transfection efficiencies. Reporter constructs are: pGL4-CCNE2 (kindly given by Jay A. Nelson laboratory) and pGL4-ΔCCNE2 that was obtained by amplifying a fragment of 223nt from pGL4-CCNE2 using the following primers: forward AATCTCGAGGTGCGGGGCGGGAC and reverse ACCCAAGCTTACGGAACGCGGGAACCCA and cloned in HindIII and XhoI restriction sites of pGL4.11 (Promega). The assays were performed with dual-luciferase reporter assay system (Promega) according to the manufacturer's instruction.

For the promoter luciferase reporter assay, HEK293T cells were inoculated in 24-wells plate. When 70% cell fusion was reached, the cells were transfected with 450 ng of the constructed report plasmids, 500 ng of RED-N1 vector or RED-N1-HMGA1 vector, or 100 μmol siHMGA1 or 100 μmol siNC, and 50 ng of pRL-CMV Renilla luciferase expression vector (Promega), which was used to normalize for the transfection efficiencies (Invitrogen). After 48 h, the luciferase activity was measured using the dual-luciferase reporter assay system (Promega) according to the manufacture’s instruction.
For the microRNA luciferase reporter assay, HEK-293 and MS751 cells were inoculated in 24-wells plate. When the 70% cell fusion was reached, 500 ng 3′UTR report plasmids were co-transfected with 100 nmol miR-221-3p mimics or miR-222-3p mimics by lipo3000 (Invitrogen). After 48 h, the luciferase activity was measured using the dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions.