Total RNA was isolated from limb buds and cells with use ISOGEN (Nippon Gene), and was reverse-transcribed with a ReverTraAce kit (Toyobo) according to the manufacturer’s instructions. Complementary DNA was used for quantitative real-time PCR (qPCR), and qPCR was performed with use of Thunderbird SYBR mix (Toyobo). β-Actin expression served as the control for messenger RNA expression. Changes in gene expression were quantified by the ΔΔCT method. The primer sequences for qPCR are described in Table S1 .
Thunderbird sybr mix
Manufactured by Toyobo
Sourced in Japan
Thunderbird SYBR mix is a pre-mixed solution designed for real-time PCR and qPCR applications. It contains SYBR Green I dye, necessary reaction components, and a *hot-start* DNA polymerase.
Automatically generated - may contain errors
Lab products found in correlation
Isogen, by Nippon Gene (2 mentions)
Revertra ace kit, by Toyobo (1 mentions)
Nucleospin rna, by Macherey-Nagel (1 mentions)
Lightcycler system, by Roche (1 mentions)
Revertra ace master mix, by Toyobo (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Revertra ace, by Toyobo (1 mentions)
5 protocols using thunderbird sybr mix
1
RNA Isolation and RT-qPCR Analysis
2
Zebrafish CRISPR Targeting of lztr1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from zebrafish was performed using NucleoSpin RNA (Macherey‐Nagel). cDNA was synthesized using ReverTra Ace Master Mix (Toyobo). Primers flanking the CRISPR‐targeted lztr1 exon (5'‐TAACACTCAACTTCGGGCCT‐3' and 5'‐TAGTAAACGCCCGACACCAT‐3') and primers located upstream of the lztr1 deletion site (5'‐TAACACTCAACTTCGGGCCT‐3' and 5'‐GGTATGCTTGCTACGCCTTG‐3') were used for the sequencing and quantitative PCR analyses, respectively. Quantitative PCR was performed using THUNDERBIRD SYBR Mix (Toyobo) and analyzed with the LightCycler System (Roche Diagnostics). Values were normalized to gapdh expression (5'‐GTGGAGTCTACTGGTGTCTTC‐3' and 5'‐GTGCAGGAGGCATTGCTTACA‐3').
3
Evaluating PCR Bias in Targeted Enrichment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to test the bias that PCR amplification might exert on the preparation of the sample for targeted enrichment, a qPCR was performed using Thunderbird SYBR mix (TOYOBO) and the StepOnePlus Real Time PCR System (Applied Biosystems). The following primers were used: for region “a” in Fig. 2F : 5′-GACAGCCCATCCTATAGCACTC-3′ and 5′-CTAGCGCTACGGGAAAAGATT-3′; for region “b”: 5′-CATACTCATCCAAACCCAAGC-3′ and 5′-GGTGCATGACTGGAAGGACT-3′ or 5′-ATCCAAACCCAAGCCCAGAT-3′ and 5′-GGGCCGTAGGCTCAACATAG-3′; for region “c”: 5′-CTGCCGATCACGATGCGTTTCC-3′ and 5′-CTGTGCTTGACGGTTTGCTATCC-3′. Rn is the ratio between the fluorescence of the reporter dye and the fluorescence of the passive reporter dye ROX. Delta Rn (∆Rn) is calculated as Rn minus the baseline.
4
Quantitative RT-PCR Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen, Grand Island, NY, USA). PrimeScript RT reagent Kit (Takara, Tokyo, Japan) was used for reverse transcription of mRNA. Complementary DNA was quantitated by qRT-PCR using a Thunderbird SYBR mix (Toyobo Co., Osaka, Japan). Actb expression served as a control for mRNA expression16 ,17 and the changes in gene expression were quantified using the ΔCT and ΔΔCT method.
5
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated in ISOGEN (319-90211, NIPPON GENE CO., LTD., Toyama, Japan) using a teflon homogenizer and was reverse-transcribed using a ReverTra Ace (TRT-101, TOYOBO CO., LTD., Osaka, Japan) according to the manufacturer’s instructions. Complementary DNA was quantitated by qRT-PCR using a Thunderbird SYBR mix (QPS-201, TOYOBO CO., LTD.). Gapdh expression served as the control for mRNA expression. Changes in gene expression were quantified using the ΔΔCT method (Livak and Schmittgen, 2001 (link)). Primer sequences are listed in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!