Hiscribe t7 kit

Manufactured by New England Biolabs

The HiScribe T7 Kit is a product offered by New England Biolabs. It is used for the in vitro transcription of RNA from DNA templates containing a T7 promoter.

Automatically generated - may contain errors

Lab products found in correlation

Qubit fluorometric quantification, by Thermo Fisher Scientific (2 mentions) 4sutp, by TriLink (2 mentions) In fusion hd kit, by Takara Bio (2 mentions) Ambion nuclease free water, by Thermo Fisher Scientific (2 mentions) Cp01 200, by PNA Bio (2 mentions) Nebnext high fidelity polymerase, by New England Biolabs (2 mentions) Nucleobond xtra midi ef kit, by Macherey-Nagel (2 mentions) Trizol extraction protocol, by Thermo Fisher Scientific (1 mentions) Serum free media, by Thermo Fisher Scientific (1 mentions) Rnazol, by Merck Group (1 mentions) Rneasy minelute cleanup kit, by Qiagen (1 mentions) Ribo zero rrna removal kit, by Illumina (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Click it rna capture kit, by Thermo Fisher Scientific (1 mentions) Cleancap ag, by TriLink (1 mentions) Nanodrop 8000 spectrophotometer, by Agilent Technologies (1 mentions) Phenol chloroform extraction, by Merck Group (1 mentions) M1y 5 triphosphate, by TriLink (1 mentions) Not1 hf, by New England Biolabs (1 mentions) Antarctic phosphatase, by New England Biolabs (1 mentions)

Spelling variants of this product

15 protocols using hiscribe t7 kit

RNAi Knockdown of Target Genes in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the RNAi knockdown of target genes, dsRNA of 500bp in length was prepared using the New England Biological T7 HiScribe kit (NEB) and purified using RNAzol (Sigma). Four wells in a 6-well plate were spotted with 15μg of dsRNA for each dsRNA target and 1×10⁶ DL1 cells [12 (link)] from Drosophila melanogaster were added in 1 mL of serum free media (Gibco) and incubated for 1 hour at 27°C before the addition of 2mL media containing 10% FBS. These cells were then incubated for 60 hours at 27°C before harvesting. Total RNA was extracted from cells in three replicates of each series using the standard TRIzol extraction protocol (Invitrogen) and resuspended in water to a concentration of 500 μg/μL. The final well in each replicate was harvested using RIPA buffer for protein Western analysis of target protein knockdown verification.

Elrod N.R., Jaworski E.A., Ji P., Wagner E.J, & Routh A. (2019). Development of Poly(A)-ClickSeq as a Tool Enabling Simultaneous Genome-wide Poly(A)-site identification and Differential Expression Analysis. Methods (San Diego, Calif.), 155, 20-29.

+ Open protocol

+ Expand

Synthesizing dsRNA for Ae. aegypti Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from a pool of five one-week-old Ae. aegypti Liverpool and Rockefeller females using the Trizol RNA extraction method. cDNA was synthesized from the total RNA using an oligo dT primer with the MMLV reverse transcriptase kit. Total cDNA was used to amplify Ae. aegypti CRVP379 (AAEL000379) using the primer set CRVP-RNAi-F and CRVP-RNAi-R (Supplementary Table S1). GFP gene was amplified using primer set GFP-RNAi-F and GFP-RNAi-R with GFP plasmid as a template (Supplementary Table S1). Amplified PCR products were purified using a Zymo DNA concentrator and cleanup kit. A total of 1 µg of PCR product was used to synthesize dsRNA using a NEB T7 HiScribe kit according to the manufacturer’s instructions. dsRNA was purified using isopropanol-sodium acetate precipitation. dsRNA was dissolved in sterile distilled water, and the concentration was measured with a Nanodrop spectrophotometer. The final concentration of the dsRNA was adjusted to 3 µg/µL.

Tikhe C.V., Cardoso-Jaime V., Dong S., Rutkowski N, & Dimopoulos G. (2022). Trypsin-like Inhibitor Domain (TIL)-Harboring Protein Is Essential for Aedes aegypti Reproduction. International Journal of Molecular Sciences, 23(14), 7736.

+ Open protocol

+ Expand

Fluorescent Protein Labeling and CRISPR Mutagenesis in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

Capped mRNA was synthesized using the HiScribe™ T7 ARCA mRNA Kit (with tailing) from linearized DNA template containing T7 promoter sequence upstream of the mFmn2-mCherry and mFmn2-I1226A-mCherry constructs. The transcribed mRNA was purified using RNeasy MinElute Cleanup Kit (Qiagen). 150 pg of mFmn2-mCherry and mFmn2-I1226A-mCherry mRNA was injected in the zebrafish embryos of desired genotype at 1-cell stage.
sgRNA and Cas9 injections for CRISPR mutants sgRNA targeting exon 1 of fmn2b was designed as previously described (Varshney et al., 2016) . T7 HiScribe kit (NEB) was used to transcribe the sgRNA DNA template with the appended T7 promoter. The sgRNA was purified using ZymoResearch clean up columns. T3 mMessage mMachine RNA synthesis kit (Ambion) was used to synthesize capped Cas9 mRNA from the pT3TS-nCas9n plasmid (kind gift from Dr Wenbiao Chen; Addgene plasmid # 46757). The synthesized Cas9 mRNA was purified using the RNeasy MinElute Cleanup Kit (Qiagen). 30 pg sgRNA and 300 pg Cas9 mRNA was injected in zebrafish embryos at 1 cell stage. The sequence of sgRNA is given below.
Fmn2b_sgRNA : GGGCGAGAGGCCTCGGCTGG (ENSDARG00000061778.6; 12:47451436-47451459, plus strand)

Nagar D., Carrington B., Burgess S.M., & Ghose A. (2021). Development of motor neurons and motor activity in zebrafish requires F-actin nucleation by Fmn2b.

+ Open protocol

+ Expand

EU-RNAseq Analysis of Cell Cycle Stages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from human cells (~ 10⁶ cells) was extracted using Trizol (Invitrogen, 15596026). Cells were collected and washed in 1xPBS prior to resuspension in 1ml Trizol. 250μl of chloroform was then added for protein extraction following RNA precipitation with isopropanol. RNA pellet was finally washed in 70% ethanol and resuspended in nuclease-free water (Ambion, AM9932). RNA levels were measured using a Biodrop and storage at −20°.
EU-labelled RNA was purified from total RNA extracted from G2, metaphase (M) or G1 arrested cells incubated with 0.25mM EU for 12 hours (G2 and M) or 2h (G1). For EU-RNAseq we previously removed the rRNA from 5μg total RNA using Ribo-Zero rRNA Removal Kit (Illumina) following the manual specifications. EU-labelled RNA was then recovered from depleted RNA (~ 500 ng) using the Click-iT RNA Capture Kit (Invitrogen, C10365). Renilla and Luciferase custom biotinylated probes were used as spike in controls in the EU-RNAseq experiment. Templates DNA were generated by PCR and in-vitro transcribed using the Hiscribe T7 kit (NEB E2030) including biotinylated UTP. Probes were purified by LiCl precipitation and added after the Click-iT reaction at 0.25ng/μl and 0.025 ng/μl final concentration respectively. Purified EU-RNA was used for either cDNA synthesis or library preparation (see below).

Perea-Resa C., Bury L., Cheeseman I.M, & Blower M.D. (2020). Cohesin removal reprograms gene expression upon mitotic entry. Molecular cell, 78(1), 127-140.e7.

+ Open protocol

+ Expand

Efficient mRNA Production for Base Editors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Base editor mRNA was prepared by T7 run-off in vitro transcription using a custom plasmid template encoding for a T7 promoter, a minimal 5′-UTR, the base editor reading frame, 2× HBB 3′-UTR and a 110–120 bp poly(A) sequence^{54 (link)}. The plasmid template was linearized by BbsI-HF restriction digestion (NEB, R3539) and purified by phenol–chloroform extraction (Sigma-Aldrich, P2069). mRNA IVT was performed using the NEB HiScribe T7 kit (E2040S) and co-transcriptionally capped with ARCA (3′-O-Me-m7G(5′)ppp(5′)G RNA cap analogue, NEB, S1411L) or CleanCap AG (Trilink, N-7113). Partial (75–85%) or total UTP substitution with N1-methyl-pseudo-UTP (Trilink, N-1103) or 5-methoxy-UTP (Trilink, N-1093) was performed as indicated. Dephosphorylation with QuickCIP (NEB, M0525L) or DNase treatment (NEB, M0303L) was added after IVT reaction (30 min at 37 °C). IVT mRNA was purified using the NEB Monarch RNA Clean up kit (T2050L) or sparQ PureMag magnetic beads (MagBio, 95196) and resuspended in RNase-free water. mRNA was quantified using the Nanodrop-8000 spectrophotometer and quality control was performed using the Agilent Fragment Analyzer with RNA Kit-15NT (Agilent, DNF-471).

Casirati G., Cosentino A., Mucci A., Salah Mahmoud M., Ugarte Zabala I., Zeng J., Ficarro S.B., Klatt D., Brendel C., Rambaldi A., Ritz J., Marto J.A., Pellin D., Bauer D.E., Armstrong S.A, & Genovese P. (2023). Epitope editing enables targeted immunotherapy of acute myeloid leukaemia. Nature, 621(7978), 404-414.

+ Open protocol

+ Expand

Synthesis and Purification of Tagged RSV Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA gblocks (IDT DNA) were designed using the full-length nucleotide sequences of GFP and RSV M2-2 and RSV M2-1 (GenBank M74568.1). The sequences contained a 5’ untranslated region (UTR) with a Kozak sequence, a 3’ UTR derived from the mouse alpha globin sequence, and extensions that allow for Gibson assembly. RSV M2-2 mRNA contained a 5’ Myc tag sequence while RSV M2-1 contained a 5’ HA tag sequence (Table 2). Sequences were codon optimized and then inserted into a pMA-7 vector using Gibson assembly using New England Biolabs Builder. Plasmids were first linearized overnight at 37°C with Not-1 HF (New England Biolabs). They were then in vitro transcribed overnight at 37°C using a HiScribe T7 kit (New England Biolabs), capped, and polyadenylated enzymatically (Aldeveron). Nucleotides used were ATP, GTP, CTP and m1Y-5’-triphosphate (Trilink). mRNAs were then purified with a lithium chloride precipitation before treatment with Antarctic Phosphatase (New England Biolabs) for 2 h. They were then purified again before storage for use.

Blanchard E.L., Braun M.R., Lifland A.W., Ludeke B., Noton S.L., Vanover D., Zurla C., Fearns R, & Santangelo P.J. (2020). Polymerase-tagged respiratory syncytial virus reveals a dynamic rearrangement of the ribonucleocapsid complex during infection. PLoS Pathogens, 16(10), e1008987.

+ Open protocol

+ Expand

Hrb98DE Knockdown in Drosophila S2R+ Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Experimental knockdown of Hrb98DE in S2R+ cells was performed using two distinct dsRNAs. Drosophila S2R+ cells were cultured at 25 °C in Schneider’s Drosophila Medium (GIBCO, Cat-No 21720) supplemented with 10% FBS and 2% penicillin/streptomycin. For knockdown experiments, dsRNA was synthesized overnight at 37 °C using the Hi-Scribe T7 kit (NEB, Cat-No-E2040). dsRNA was transfected in S2R+ cells by serum starvation for 6 h. The treatment was repeated twice and cells were harvested 5 days after the first treatment. Primer sequences to amplify dsRNA templates are listed in Supplementary Table 1.

Becker K., Bluhm A., Casas-Vila N., Dinges N., Dejung M., Sayols S., Kreutz C., Roignant J.Y., Butter F, & Legewie S. (2018). Quantifying post-transcriptional regulation in the development of Drosophila melanogaster. Nature Communications, 9, 4970.

+ Open protocol

+ Expand

Protocol for Optimized mRNA Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid templates were designed using Geneious software, and codon optimized and ordered from GenScript. Plasmids were linearized with Not‐I HF (New England Biolabs) overnight at 37 °C. Linearized templates were purified by sodium acetate (Thermo Fisher Scientific) precipitation and rehydrated with nuclease‐free water. In vitro transcription was performed overnight at 37 °C using a HiScribe T7 Kit (NEB) following the manufacturer's instructions (complete N1‐methyl‐pseudouridine modification). The resulting RNA was treated with DNase I (Aldevron) for 30 min and purified using lithium chloride precipitation (Thermo Fisher Scientific). The RNA was heat denatured at 65 °C for 10 min before capping with a Cap‐1 structure using guanylyl transferase and 2′‐O‐methyltransferase (Aldevron). mRNA was then purified by lithium chloride precipitation, treated with alkaline phosphatase (NEB), and purified again. mRNA concentration was measured using a Nanodrop. mRNA stock concentrations were 1–3 mg mL⁻¹ and were stored at −80 °C until use. Purified mRNA products were analyzed by gel electrophoresis to ensure purity.

Vanover D., Zurla C., Peck H.E., Orr‐Burks N., Joo J.Y., Murray J., Holladay N., Hobbs R.A., Jung Y., Chaves L.C., Rotolo L., Lifland A.W., Olivier A.K., Li D., Saunders K.O., Sempowski G.D., Crowe JE J.r., Haynes B.F., Lafontaine E.R., Hogan R.J, & Santangelo P.J. (2022). Nebulized mRNA‐Encoded Antibodies Protect Hamsters from SARS‐CoV‐2 Infection. Advanced Science, 9(34), 2202771.

+ Open protocol

+ Expand

In vitro Synthesis of Fluorescent mRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Constructs encoding either a GFP or an RFP protein were PCR amplified using the following primers: F 5′– gaaatacgactcactataggggccacccaagctcatcgattcgaattcatg–3′ and R 5′– gcggccgcagacatgataag–3′, and in vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP, CTP, GTP and UTP in transcription of GFP, or replacing UTP with 4sUTP (TriLink Biotechnologies) in transcription of RFP, to produce RFP mRNAs that were in vitro transcribed with 100% 4sU residues. Resulting mRNA levels were quantified by Qubit fluorometric quantification (Thermo Fisher) and mRNA length was validated by gel electrophoresis. For barcode mixing controls, mRNAs encoding mCherry with C-terminal fusions of either SV40 or nucleoplasmin nuclear localization signals were transcribed from pCS2-SV40nls-mCherry-SV40nls or pCS2-SV40nls-mCherry-NPLnls plasmids, using the mMessage Machine SP6 kit (Ambion/ThermoFisher).

Fishman L., Modak A., Nechooshtan G., Razin T., Erhard F., Regev A., Farrell J.A, & Rabani M. (2024). Cell-type-specific mRNA transcription and degradation kinetics in zebrafish embryogenesis from metabolically labeled single-cell RNA-seq. Nature Communications, 15, 3104.

+ Open protocol

+ Expand

In vitro transcription of modified cytidine RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

In vitro transcription was performed with the HiScribe T7 Kit (New England BioLabs), according to the manufacturer’s instructions using DNA templates containing a T7 promoter upstream of a template sequence harboring a single cytidine, as described previously.^{18 (link)} To produce RNAs containing modified cytidines, CTP was replaced in the reaction mixture with 5mCTP, 5hmCTP, 5fCTP, or 5caCTP (5 mM). The synthesized RNA was mixed with 1× RNA denaturing RNA loading buffer and heated at 95 °C for 4 min, cooled on ice, loaded onto a 14% denaturing polyacrylamide gel, and run at 400 V (20 V/cm) for 5 h. Gel bands were excised, put in the crush-and-soak buffer at 4 °C overnight, and desalted to yield pure RNA for reaction-based sequencing analyses.

Jucker B.M., Dufour S., Ren J., Cao X., Previs S.F., Underhill B., Cadman K.S, & Shulman G.I. (2000). Assessment of mitochondrial energy coupling in vivo by 13C/31P NMR. Proceedings of the National Academy of Sciences of the United States of America, 97(12), 6880-6884.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!