Sybr green qpcr mix

Total RNA was separated from each sample using TRIzol regent (Invitrogen, Carlsbad, CA, USA) and the cDNA was synthesized using a cDNA Synthesis SuperMix Kit (TransGen, Beijing, China) according to the manufacturer’s instructions. Gene expression for three replicates was determined using qRT-PCR using SYBR Green qPCR Mix (TransGen, Beijing, China). The OsUFC1 [40 (link)] was utilized as the endogenous control for normalization. The following standard thermal profile was used for qRT-PCR: 95 °C for 3 min; 40 cycles of 95 °C for 10 s; 60 °C for 15 s; 72 °C for 20 s.

Total RNA was extracted from mice tissues using TRIzol reagent (TaKaRa, Dalian, China). RNA purity and concentration were determined by optical density measurement at 260 nm on a spectrophotometer (IMPLEN, Germany). Then, RNA was reversely transcribed to cDNA using an iScript cDNA synthesis kit (TIANGEN, Beijing, China). qPCR was performed SYBR Green qPCR Mix (TransGen Biotech) according to the manufacturer's instructions. The results were normalized to GAPDH. Primers are listed in Table S1.

According to our previous study (Wu et al., 2016 (link)), the tissues of NTS were collected by punching. The tissue from a single rat was recorded as one sample. Total RNA of NTS tissue was extracted with TransZol UP reagent (TransGen Biotech, China), and then RNA was reverse-transcribed to cDNA using a reverse transcription kit (TransGen Biotech, China). The cDNA was amplified by SYBR Green qPCR Mix (TransGen Biotech, China). Quantitative PCR amplification was performed on LightCycler96 Instrument (Roche, United States) using the two-step PCR amplification standard program. The relative expression was calculated by the 2^−ΔΔCt method and normalized to GAPDH. The primer sequences used in present study are shown below. GAPDH: Forward primer GACATGCCGCCTGGAGAAAC, Reverse primer AGCCCAGGATGCCCTTTAGT; AT1R: Forward primer GCCAAAGTCACCTGCATCAT, Reverse primer AATTTTTTCCCCAGAAAGCC.

The total RNA was extracted using TRIzol reagent (Invitrogen), and then treated with RNase-free DNase I (Invitrogen) according to the manufacturer’s protocol. The RNA was reverse-transcribed using a cDNA synthesis kit (TRANSGEN). Quantitative real-time PCR (qRT-PCR) was performed from cDNA using SYBR Green qPCR mix (TRANSGEN, AQ101) following the manufacturer’s instructions on an Applied Biosystems 7900HT Fast Real-Time PCR System. Fold changes were calculated using the ∆Ct method, each assay was replicated by at least three time with three biological replicates (independent RNA preparations). The rice Actin3 (LOC_Os03g61970) was used as a reference. Relevant primer sequences were given in Supplementary Data 6.