All animal research was approved by the University of Notre Dame IACUC under protocol 16–026. JM8.N4 embryonic stem cells (ESCs, C57BL/6N strain) heterozygous for a targeted “knockout first” allele of Arid3b (Arid3btm1a(KOMP)Wtsi/+) were obtained from the KOMP repository (S1 Fig ). Chimeric mice were generated by the IUSM Transgenic and Knock-out mouse core facility by injecting heterozygous ESCs into C57BL/6N blastocysts. Blastocyts were implated into foster mothers to generate chimeric mice. Male chimeras were mated to female C57BL/6N mice to generate mice with germline transmission of the “knockout first” allele. To generate mice harboring a conditional allele of Arid3b (Exon 5 flanked by LoxP sites), Arid3btm1a(KOMP)Wtsi/+ heterozygous mice were mated to B6;SJL-Tg(ACTFLPe)9205Dym/J (Stock Number: 003800, Jackson Laboratories, Bar Harbor, ME). The resultant Arid3bf/f mice were mated to B6.Cg-Tg(Mx1-cre)1Cgn/J (Stock Number: 003556, Jackson Laboratories, Bar Harbor, ME) to generate Arid3bf/f: Mx1-cre mice. Knockout of the Arid3b allele was induced by intraperitoneal injection of 3–4 week old mice with 3 doses of poly-pIpC that were administered every 2 days apart. Deletion of the targeted Arid3b exon 4 was evaluated by PCR with the primers CTCGAAAGAGCACATATTGCAG and TTCCCTGGGAGACCTTTATG .
B6 sjl tg actflpe 9205dym j
Manufactured by Jackson ImmunoResearch
Sourced in Montenegro
The B6;SJL-Tg(ACTFLPe)9205Dym/J is a genetically modified mouse strain. It expresses the Flp recombinase enzyme under the control of the human beta-actin promoter.
Automatically generated - may contain errors
Lab products found in correlation
Balb c, by Jackson ImmunoResearch (2 mentions)
B6 cg tg mx1 cre 1cgn j, by Jackson ImmunoResearch (1 mentions)
B6.129s2 tcratm1mom j, by Jackson ImmunoResearch (1 mentions)
B6.129s2 h2dlab1 ea j, by Jackson ImmunoResearch (1 mentions)
B6 pl thy1a cyj, by Jackson ImmunoResearch (1 mentions)
B6 cg tg tcratcrb 425cbn j, by Jackson ImmunoResearch (1 mentions)
B6.129s7 rag1tm1mom j, by Jackson ImmunoResearch (1 mentions)
C57bl 6, by Jackson ImmunoResearch (1 mentions)
Cmv cre mice, by Jackson ImmunoResearch (1 mentions)
B6 cg tg mx1 cre 1cgn j mice, by Jackson ImmunoResearch (1 mentions)
Mir23btm1m, by Jackson ImmunoResearch (1 mentions)
B6 fvb tg eiia cre c5379lmgd j, by Jackson ImmunoResearch (1 mentions)
C57bl 6j sting1gt j, by Jackson ImmunoResearch (1 mentions)
Fvb nj, by Jackson ImmunoResearch (1 mentions)
C57bl 6j, by Jackson ImmunoResearch (1 mentions)
Ganciclovir, by Roche (1 mentions)
9 protocols using b6 sjl tg actflpe 9205dym j
1
Generation of Arid3b Conditional Knockout Mice
2
Generation of STING R231H Knock-In Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A similar approach as described for the HAQ knock-in mice (29 (link)) was used to generate the R231H knock-in mice. A linearized targeting vector (Figure S1A ) which covers ~10 kb of the genomic region in the STING locus on mouse chromosome 18, with the R231H point mutation, was transfected into C57BL/6-derived JM8.A3 embryonic stem cells. Clones were selected for neomycin positive and diphtheria toxin negative clones. Successful targeting was assessed by PCR. Positive clones were injected into C57BL/6J blastocytes and implanted. Chimerism was determined by coat color and males with high chimerism were bred with female C57BL/6 females to select for germline transmission. Successful germline transmission was confirmed by DNA sequencing. These mice were crossed with the FLP1 recombinase line (B6;SJL-Tg(ACTFLPe)9205Dym/J, Jackson Laboratory, ME.) to remove the neo gene, generating the STING R231H knock-in line. To validate successful introduction of the R231H generating point mutation exon 6 was amplified by PCR (Exon 6-F, 5′-TCACACTGAGAAGGCTAACGAGC-3′; Exon 6-R, 5′-CACCATAGAACAGGGATCACGC-3′) and sequenced (Figure S1B ).
3
Generation and Characterization of Capzb Conditional Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Capzbtm1a(EUCOMM)Wtsi frozen embryos were obtained from the European Conditional Mouse Mutagenesis Program and rederived using standard procedures; mice were backcrossed to C57BL/6 (presently eight or more generations). The FRT-flanked neo cassette was removed by crossing with the Flp deleter line B6;SJL-Tg(ACTFLPe)9205Dym/J (003800; Jackson Laboratories), generating Capzbfl mice; PCR genotyping was used to verify loss of the cassette. To produce CapzbCKO mice, we used the Atoh1-Cre mouse line (Matei et al., 2005 (link)), which was provided by B. Frizsch (University of Iowa, Iowa City, IA). Crossing Atoh1-Cre with the Ai14 reporter line (Madisen et al., 2010 (link)), we found that >99% of cochlear and vestibular hair cells, identified with anti-MYO7A, were positive for the tdTomato reporter at P2 or P7 (Fig. S3). These data coincided with previous studies demonstrating that CRE activity was widespread among hair cells using Atoh1-Cre (Matei et al., 2005 (link); Pan et al., 2012 (link)). CapzbCKO mice were then generated from a Capzbfl/fl and Capzb+/fl;Atoh1-Cre cross; heterozygous control mice were fl/+ Cre+, whereas wild-type mice were fl/fl Cre- or fl/+ Cre-. We used a variety of ages for our experiments; in general, however, we used windows of P1, P7–P9, and P21–P25 for examining developmental progressions.
4
Generation of DNAM-1 Y319F Mutant Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate a mouse strain in which Y319 of DNAM-1 was substituted by phenylalanine, the targeting vector depicted in Fig. 3 A was created. This construct contained a 5-kb 3′ arm harboring exon 7, in which the codon for Y319 (TAT) was replaced by the codon for phenylalanine (TTT). The construct was transfected in C57BL/6-derived Bruce 4 ES cells. Cells with successful homologous recombination were injected into blastocysts to generate chimeric mice. After germline transmission, mice were crossed with a transgenic mouse expressing the Flpe recombinase [B6.SJL-Tg(ACTFLPe)9205Dym/J; The Jackson Laboratory] to eliminate the neo cassette. Presence of the DNAM-1 Y319F mutation was confirmed by sequencing of mouse genomic DNA. DNAM-1–deficient mice in the C57BL/6 background were previously described (Gilfillan et al., 2008 (link)). LFA-1–deficient mice (B6.129S7-Itgaltm1Bll/J) were obtained from The Jackson Laboratory (Ding et al., 1999 (link)). Mice lacking Fyn were described previously (Dong et al., 2012 (link)). All mice were maintained in the C57BL/6 background. Littermates were used as controls in all experiments. Animal experimentation was approved by the Animal Care Committee of IRCM and performed as defined by the Canadian Council of Animal Care.
5
Mouse Strains for Immunology Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6, BALB/c, B6.PL-Thy1a/CyJ (Thy1.1), B6.129S2-H2dlAb1-Ea/J (MHCII−/−), B6.129S2-Tcratm1Mom/J (TCRα−/−), B6.129S7-Rag1tm/1Mom/J (Rag1−/−), B6.Cg-Tg(Itgax-cre)1-1Reiz/J (CD11c-CRE), B6.Cg-Tg(UBC-cre/ERT2)1Ejb (ERT-CRE), B6;SJL-Tg(ACTFLPe)9205Dym/J (ACT-FLP), B6.Cg-Tg(TcraTcrb)425Cbn/J (OT-II), and B6.SJL-Ptprca Pepcb/BoyJ (BoyJ) mice were purchased from the Jackson Laboratory. B6.129-H20Ab1tm1GruN12 (MHCIIβ−/−) mice were purchased from Taconic. MHCIIK>R/K>R (Oh et al., 2013 (link)), MARCH1−/− (Matsuki et al., 2007 (link)), Rip-mOVA (Kurts et al., 1996 (link)), foxp3GFP (Haribhai et al., 2007 (link)), and TCli β transgenic (Hsieh et al., 2004 (link)) mice were described previously. All mice were maintained in the University of California, San Francisco (UCSF), mouse facility, and all animal studies were performed according to protocols approved by the UCSF Institutional Animal Ethics Committee.
6
Conditional Mouse Genetic Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CMV-Cre mice (Jackson lab, stock#: 006054) (ref. [15 (link)]), FSF-R26CAG − CreERT2/+ mice (ref. [17 (link)]), the human beta-actin FLPe deleter strain of mice (B6;SJL-Tg (ACTFLPe)9205Dym/J, the Jackson Laboratory, Stock Number: 003800) and R26CAG − CreERT2/+ mice [24 (link)] have been described previously [20 (link)]. The mice were all on a mixed C57Bl/6;129S6/SvEv genetic background. All mice were kept at a SPF environment, no mice were excluded from analyses. Experiments with mice were performed with protocols approved by the Shandong University Institutional Animal Care and Use Committee, complying with the rules of Regulations for the Administration of Affairs Concerning Experimental Animals (Approved by the State Council of China). Mice after the study were all euthanized by cervical dislocation.
7
Generation of Conditional and Null Allele for miR-23b
8
Genetically Engineered Mouse Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The experiments on the mice were conducted according to the approval (KA2017-30) of the Animal Care Committee of Korea Advanced Institute of Science and Technology (KAIST). Specific pathogen-free C57BL/6 J, FVB/NJ, Balb/c, STING knockout (C57BL/6J-Sting1gt/J), MMTV-PyMT transgenic [FVB/N-Tg(MMTV-PyVT)634Mul/J], LysM-Cre (B6.129P2-Lyz2tm1(cre)Ifo/J), TNFR1 knockout (C57BL/6-Tnfrsf1atm1Imx/J), and B6.Cg-Tg(Tyr-cre/ERT2)13Bos Braftm1MmcmPtentm1Hwu/BosJ (Tyr-Cre-ERT2;BrafCA;PtenloxP) mice were purchased from Jackson Laboratory (USA). VE-cadherin-Cre-ERT2 mice36 (link) were provided by Prof. Yoshiyaki Kubota (Keio University, Japan), transferred, established and bred in SPF animal facilities at KAIST. STING1tm1a(EUCOMM)Hmgu mice, which have conditional knockout potential with frt-flanked lacZ and neomycin resistance cassette followed by loxP-flanked exon 6, were purchased from EUMMCR. To generate STINGflox mice, STINGtm1a(EUCOMM)Hmgu mice were crossed with FLP1 recombinase expressing mice (B6;SJL-Tg(ACTFLPe)9205Dym/J), which were purchased from Jackson laboratory. All mice were fed with ad libitum access to standard diet (PMI lab diet) and water, and were anesthetized by i.p. injection of a combination of anaesthetics (80 mg/kg of ketamine and 12 mg/kg of xylazine) before all the procedures and being sacrificed.
9
Generation of Wwp1/2 Conditional Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Generation of Wwp1/2 f/f mouse line Bacterial artificial chromosome clones covering from the 3rd to the 6th introns of Wwp1 and form 5th to 6th introns of Wwp2 were cloned into pL253 plasmid. Two loxP sites flanking 6th exons of Wwp1 and Wwp2 together with one neomycin cassette and two FRT sites were integrated in these plasmids (Figure S1A) by recombineering method (Liu et al., 2003) . After transfection of one of two targeting vectors to ES cells derived from 129/OlaHsd mouse line, ES cells were cultured in the presence of G418 (Invitrogen) and Ganciclovir (Roche) to select clones with proper homologous recombination. ES cells were validated with Southern blotting (Figures S1C andS1E) and injected into blastocysts (Thomas and Capecchi, 1987) . Mice derived from such ES cells were crossed with flip recombinase expressing mouse line (B6;SJL-Tg(ACTFLPe)9205Dym/J; Jackson Laboratory) to delete the Neo cassette. Wwp1 f/+ and Wwp2 f/+ mice were crossed to establish Wwp1/2 f/f mouse line.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!