The lentivirus particles for CTTN overexpression or knockdown were designed and constructed by Shanghai GenePharma Co., Ltd. (Shanghai, China) SW1116 cells were transduced with Lenti-vector or Lenti-NDRG3 at 20 multiplicity of infection in the presence of 8 μg/mL polybrene (Sigma-Aldrich Co., St Louis, MO, USA). RKO cells were transduced with Lenti-control or Lenti-sh NDRG3 at 20 multiplicity of infection in the presence of 8 μg/mL polybrene. Stable cell lines were selected in 2 μg/mL puromycin.
Lentivirus particles
Manufactured by GenePharma
Sourced in China
Lentivirus particles are a type of retroviral vector used for gene delivery and expression in various cell lines. They are derived from the human immunodeficiency virus (HIV) genome, but have been modified to be replication-deficient and safer for research applications. Lentivirus particles can be used to efficiently transduce a wide range of cell types, including dividing and non-dividing cells, and integrate the gene of interest into the host cell's genome.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Merck Group (2 mentions)
Facsaria 2, by BD (1 mentions)
Puromycin selection, by Solarbio (1 mentions)
Inverted fluorescence microscope, by Olympus (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Mir 497 mimics, by GenePharma (1 mentions)
Si hcp5, by GenePharma (1 mentions)
Si igf1, by GenePharma (1 mentions)
6 protocols using lentivirus particles
1
Lentiviral Vector-Mediated Overexpression and Knockdown
2
Overexpression and Knockdown of AFF4 in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid and lentivirus particles for AFF4 overexpression or knockdown were designed by Shanghai GenePharma Co., Ltd. (Shanghai, China). The pGIPZ control or pGIPZ AFF4 shRNA was generated by inserting a small hairpin RNA targeting GFP or human AFF4 ORF (NM_014423.4) with a sequence 5′-cccaagcctacagtaccacca-3′ for #1 or 5′-cctccatctgcaccaactctt-3′ for #2 into the pGIPZ vector. HCT116 and LoVo cells were transduced with Lenti-GFP (EV) or Lenti-AFF4 OV (AFF4 OV) at 20 MOI in the presence of 8 μg/ml of polybrene (Sigma, St. Louis, MO, USA). HT29 and DLD-1 cells were infected with Lenti-control (shNT) or Lenti-shAFF4#1 (shAFF4#1) and Lenti-shAFF4#2 (shAFF4#2) at 20 MOI in the presence of 8 μg/ml polybrene. Cell selection was continuously performed in puromycin for 36 h and passages were performed (2 μg/ml).
3
Overexpression of YAP1 in Colon Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus particles expressing YAP1 were produced by GenePharma Co. Ltd. China. HT-29, and Caco-2 cells were transfected with the Lentivirus particles using an LV5 vector with a YAP1 insert. Stably transfected cells with GFP were sorted using flow cytometry (BD FACS Aria II; BD Biosciences, Franklin Lakes, NJ, USA) and isolated using puromycin selection (Solarbio, Beijing, China).
4
Lentiviral Transduction of ADSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentivirus particles used in this study were purchased from GenePharma company (China). First, 1 × 105 ADSCs were plated in a 6‐well plate and incubated overnight in conventional growth medium under the condition of 37°C/5% CO2 and saturated humidity. Next, cells were incubated with lentiviral particles and 5 μg/mL polybrene in conventional growth medium at a multiplicity of infection (MOI) of 50. After 24 hours, the results were observed under a light microscope (OLYMPUS, Japan) and an inverted fluorescence microscope (OLYMPUS, Japan). Two days later, the expression of miR‐130a‐3p was measured by qPCR to see whether transfection is successful or not. It was illustrated more in Materials and Methods 2.7.
5
Lentivirus-Mediated Gene Knockdown in PMVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviruses were packaged using a four-plasmid system as proposed before (Tiscornia et al., 2006 (link)). The lentivirus particles (GenePharma Co., Ltd., Shanghai, China), which express short hairpin RNA (shRNA) or a negative control shRNA (targeting Ezrin shRNA sequence, GGATCAACTATTTCGAGATCA; targeting RhoA shRNA sequence, AAGGATCTTCGGAATGATGAG; targeting FAK shRNA sequence, AAGCTGCTGAACTCCGACTTG; negative control sequence, GTTCTCCGAACGTGTCACGT), were used to infect PMVECs that were seeded in a 6-well plate (1 × 106 cells/well). When the cells reached 40–60% confluence, the medium was replaced with 20% FBS of DMEM, lentiviruses, and 5 μg/ml polybrene for 24 h. Then, the supernatant with lentivirus particles was replaced by the normal culture medium containing 20% FBS for 48 h. The effect of lentivirus transfection was observed under a fluorescence microscope (Supplementary Figure S5 ) and that of gene knockdown was examined by Western blotting.
6
Lentivirus-mediated Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus particles expressing sh-HCP5, pcDNA3.1 HCP5, si-HCP5, miR-497 mimics, si-IGF1, as well as their negative control were synthesized and purchased from GenePharma (Shanghai, China). The transfection was performed using Lipofectamine 3000 (Invitrogen, CA, USA) as the manufacturer's guidance described. Briefly, cells were grown up to 70-80% confluence and then 1 μg plasmid together with 1 μL Lipofectamine 3000 were added into the culture medium.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!