TRIzol reagent (Invitrogen, USA) was used to isolate total RNA from tissues and cells. The Biospin miRNA Extraction Kit (Bioer Technology, China) was used to extract miRNAs according to the manufacturer’s instructions. Evo M-MLV RT Premix (Accurate Biology, China) and Mir-X™ miRNA First-Strand Synthesis (Takara, USA) were used to synthesise cDNA from total RNA and miRNA, respectively. qRT-PCR was performed using the Premix Pro Taq HS qPCR Kit (Accurate Biology, China) on a LightCycler 480 (Roche, USA) or ABI QuantStudio 3 system (Thermo, USA). GAPDH and U6 were served as internal standard controls. All assays were replicated three times. The primers used for qRT-PCR were purchased from Accurate Biology (China). The sequences of all primers are listed in Supplementary Table 3 .
Premix pro taq hs qpcr kit
Manufactured by Accurate Biology
Sourced in China, United States
The Premix Pro Taq HS qPCR Kit is a ready-to-use master mix for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, to perform qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Evo m mlv rt premix, by Accurate Biology (3 mentions)
Mir x mirna first strand synthesis, by Takara Bio (1 mentions)
Biospin mirna extraction kit, by Bioer (1 mentions)
Abi quantstudio 3 system, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Lightcycler 96 instrument, by Roche (1 mentions)
Evo m mlv rt premix for qpcr, by Accurate Biology (1 mentions)
Abi steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Accurate Biology (1 mentions)
Trizol reagent, by Accurate Biology (1 mentions)
Abi 7500 sequencing detection system, by Thermo Fisher Scientific (1 mentions)
Evo m mlv rt mix kit, by Accurate Biology (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
8 protocols using premix pro taq hs qpcr kit
1
RNA Extraction and qRT-PCR Analysis
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total RNA from tissues and cells using TRIzol reagent (Invitrogen, USA) and then synthesized cDNA from total RNA using Evo M-MLV RT Premix (Accurate Biology, China), according to the manufacturer’s instructions. qRT-PCR was performed in triplicate on a LightCycler 96 instrument (Roche, USA) using Premix Pro Taq HS qPCR Kit (Accurate Biology, China). The relative RNA expression levels were analysed using the 2−ΔΔCT method, with the levels normalized to GAPDH. All PCR primers were obtained from Accurate Biology (China). Supplementary Table 2 listed the all sequences.
3
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples using TRIzol reagent (15596018, Invitrogen, Carlsbad, CA), and cDNA was generated and then amplified with Evo M-MLV RT Premix for qPCR (AG11706, Accurate Biotechnology, Hunan, China), followed by qRT-PCR on an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA) using a Premix Pro TaqHS qPCR Kit (Accurate Biotechnology, AG11701, Hunan, China). The primers (see Supplementary Table (available here )) were synthesized by Sangon Biotech (Shanghai, China). Relative quantification was calculated using the 2–ΔΔCT formula, and the expression data were normalized with GAPDH or β-actin gene expression.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using TRIZOL (Accurate Biology, China). After measuring the concentration of RNA, 1 µg total RNA was used to perform the reverse transcription using the RT Kit with gDNA Clean for qPCR (Accurate Biology, China). Then the product of reverse transcription was diluted 10 times with deionized water. Finally, RT-qPCR was performed using the Premix Pro Taq HS qPCR Kit (Accurate Biology, China) on ViiA™ 7 RT-PCR system. All the primers are summarized as follows: β-Actin-F: CTCCATCCTGGCCTCGCTGT, β-Actin-R: GCTGTCACCTTCACCGTTCC; SEH1L-F: TCTTCTGCTGGCAGGTATTTCT, SEH1L-R: AGTGTCAGCATCGCAAGAGT. ATF3-F: CTCGGGGTGTCCATCACAAA, ATF3-R: GGCACTCCGTCTTCTCCTTC; CA9-F: GGCTACAGCTGAACTTCCGA, CA9-R: TGACAGCAAAAAGGAGGCCA; CP-F: CTCACAATGCACGTGGGAGA, CP-R: CAGCCAGATTTGGTGTCTTCATTT; HMOX1-F: ACTCCCTGGAGATGACTCCC, HMOX1-R: TCTTGCACTTTGTTGCTGGC, NR1D-F: CAACACAGGTGGCGTCATCA, NR1D-R: CTGGAAGCTGCCATTGGAGT; SCD-F: CTTGCGATATGCTGTGGTGC; SCD-R: CCGGGGGCTAATGTTCTTGT; TNFAIP3-F: TCCACAAAGCCCTCATCGAC, TNFAIP3-R: TTCGTTTTCAGCGCCACAAG.
5
Total RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated according to TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse‐transcribed to cDNA by Evo M‐MLVRT Premix (AG11706, Accurate Biotechnology, Shanghai, China). Real‐time PCR was performed with the Premix Pro Taq HS qPCR Kit (AG11701, Accurate Biotechnology, Changsha, China). The cycle of threshold (CT) of each sample was averaged and normalized to GAPDH. The triplicate results were analyzed by comparative CT equation (2−△△CT).
6
Quantifying Cellular Transcripts by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from the cultured cells using TRIzol reagent (Accurate Biology, Hunan, China). For reverse transcription, total RNA was processed using an Evo M-MLV RT Kit for qRT-PCR (Accurate Biology). For qRT-PCR, cDNA was reverse transcribed from total RNA using a Premix Pro TaqHS qPCR Kit (Accurate Biology) in an ABI 7500 sequencing detection system (Applied Biosystems, Foster City, CA, USA). The relative quantities of full-length circKIF18A, circKIF18A fragments, and mRNAs were normalized to ACTB.
7
Quantitative Expression Analysis of Autophagy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Takara, Japan). In accordance with the manufacturer's protocol, quantitative reverse transcription PCR (qRT-PCR) was conducted using their respective RNA as the template with an Evo M-MLV RT Mix Kit (with gDNA Clean) and a Premix Pro Taq HS qPCR Kit (SYBR Green) (Accurate Biotechnology (Hunan) Co., Ltd). Each sample was amplified in triplicate using an sds7500 instrument (Thermo Fisher Scientific, New York, USA). The levels of target gene messenger ribonucleic acid (mRNA) were normalized against the levels of the endogenous control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and presented as 2−△△Ct. The primer sequences for qRT-PCR analysis were presented in Table 1 .Table 1
Primer sequences for qRT-PCR.
| Gene | Forward (5′-3′) | Reserve (5′-3′) |
|---|---|---|
| LOX-1 (ΜM_001172632.2) | GAAGAGAGTAGCAAATTGTTCAGGA | ATAAGTGGGGCATCAAAGGAGA |
| LC3II (ΜM_022818.5) | TCCGAGAAGACCTTCAAACAGC | AAGAAGGCTTGGTTAGCATTGAG |
| Beclin-1 (ΜM_001313998.2) | AGGAGTTGCCGTTGTACTGTTCT | GTGTCTTCAATCTTGCCTTTCTCC |
| GAPDH (ΜM_002046) | GGAAGCTTGTCATCAATGGAAATC | TGATGACCCTTTTGGCTCCC |
8
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer's instructions, the TRIzol reagent (Invitrogen, LA, USA) was used to extract the RNA from cell lines or tissues. The primers were synthesized by Guangzhou Ige Biotechnology Ltd. (Guangzhou, China). Premix Pro Taq HS qPCR Kit (No. AG11702, Accurate Biology, Hunan, China) was used for quantitative PCR, while reverse transcription kit(No. AG11711, Accurate Biology, Hunan, China) was used for reverse transcription. The relative transcription levels of target genes were compared with those of the internal control glycerol tris phosphate dehydrogenase (GAPDH) for normalization. 2 -ΔΔCt analysis was performed on the data.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!