Primescript rt master mix perfect

First, complementary DNA (cDNA) was generated from the extracted total RNA using PrimeScript™ RT Master Mix (Perfect Real Time; Takara Bio Inc.; Shiga, Japan). Real-time PCR and quantification of PCR products were performed on a Thermal Cycler Dice TP800 (Takara Bio Inc., Madison, WI, USA) using SYBR Premix Ex Taq II (Takara Biotechnology Co., Ltd., Shiga, Japan). Primers were designed using Primer3Plus, and their sequences are listed in Table S2. The qPCR thermal cycling conditions were as follows: Denaturation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, then annealing and extension at 60 °C for 30 s. The relative expression levels of products were normalized to the housekeeping gene β-actin (Actb) for the hippocampus, cerebellum, and cerebral cortex. For liver samples, the relative expression was normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (Gapdh). All samples were analyzed in triplicate.

Total RNA was isolated using RNAiso Plus (Takara Biomedical Technology (Beijing) Co., Ltd, China) and 1 µg of RNA was reverse transcribed with the PrimeScript^™ RT Master Mix (Perfect Real Time) (Takara Biomedical Technology) according to the manufacturer’s protocol. qRT-PCR was performed using the Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Inc. Waltham, MA, USA). Expression of the genes of interest was analyzed using the GAPDH gene as the internal control and the ΔΔCt method. Real time primer information is provided in Table 1.

Total RNA was extracted from the recovered cells using the RNeasy Mini Kit (74104; Qiagen), and the total RNA was treated with DNase I (100 U) of the RNase-Free DNase Set (79254; Qiagen) for 15 min at room temperature. RNA was cleaned up using the RNeasy Mini Kit. The RNA concentration was quantified with NanoDrop (ND-1000) (NanoDrop Technologies), and 500 ng of total RNA was reverse-transcribed with PrimeScript RT Master Mix (Perfect Real Time) (RR037A; Takara) to synthesize cDNA. The PCR enzyme used was TB Green Premix Ex Taq II (Tli RNaseH Plus) (RR820A; Takara), and quantitative PCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems). The PCR primers used are listed in Table S1.

Table S1 Primers used for PCR in this study.

Total RNA from GC cells and tissue specimens was extracted with Simply P Total RNA extraction Kit (BioFlux), and 2 μg of total RNA from each sample was reversely transcribed into cDNA using PrimeScript^™ RT Master Mix (Perfect Real Time; Takara). qRT‐PCR was performed using SYBR^® Premix Ex Taq^™ (Tli RNaseH Plus; Takara) in a Light Cycler Real‐time PCR System (Roche). The amplification was performed as follows: an initial denaturation step for 30 seconds at 95°C followed by 40 cycles of denaturation for 5 seconds at 95°C, annealing and extension for 30 seconds at 60°C. The specific primers used were as follows: GAPDH‐F: GGGAAGGTGAAGGTCGGAGT; GAPDH‐R: GGGGTCATTGATGGCAACA; HOXA10‐F: TCACGGCAAAGAGTGGTC; HOXA10‐R: AGTTTCATCCTGCGGTTCTG; BCL2‐F: ACTGGCTCTGTCTGAGTAAG; BCL2‐R: CCTGATGCTCTGGGTAAC. GAPDH was used as an internal control, and the relative quantities (Δ cycle threshold values) of each transcript were normalized to GAPDH. Each reaction was repeated in triplicate. The fold changes (2^−ΔΔCt) in HOXA10 and BCL2 mRNA expression were calculated using the following formulae: HOXA10ΔCt = (Avg. HOXA10_Ct − Avg. GADPH_Ct), HOXA10ΔΔCt = (HOXA10ΔCt_tumor − HOXA10ΔCt_non‐tumor); BCL2ΔCt = (Avg. BCL2_Ct − Avg. GADPH_Ct), BCL2ΔΔCt = (BCL2ΔCt_tumor − BCL2ΔCt_non‐tumor).