Piggybac transposase vector

Human full‐length VSIG1 variant 2 cDNA, reverse transcribed from the RNA obtained from human non‐cancerous gastric tissue, was amplified by PCR using Phusion High‐Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA, USA) and cloned into a PiggyBac cumate switch inducible vector (System Biosciences, Mountain View, CA, USA). The plasmid vector sequence was confirmed by sequencing. MKN1, MKN28, H1299, and KYSE150 cells were transfected with the VSIG1‐variant 2 construct or with an empty vector using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA, USA) with a PiggyBac transposase vector (System Biosciences). Following puromycin selection, stably transfected cells were established and maintained with the same puromycin concentration. Cumate induction solution (System Biosciences) at a 1× concentration was used to induce VSIG1 expression. Transfection with siRNAs, directed against two sites in the VSIG1 mRNA sequence, was undertaken in MKN45 cells using Lipofectamine 2000 by the reverse transfection method at a final concentration of 250 nM. MKN45 cells were cultured for 4 days with siRNA and used for further analysis. The sequences of the siRNAs, all of which were purchased from Invitrogen, were as follows: VSIG1‐siRNA‐1, 5′‐UCCUCAACGUCAGUGUGUUAGUGAA‐3′; and VSIG1‐siRNA‐2, 5′‐CGUCAGUGUGUUAGUGAAACCUUCU‐3′. The negative control siRNAs were obtained from Invitrogen.