7500 real time polymerase chain reaction

TRizol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from PBMCs. First-strand cDNA was synthesized using the First-Strand Synthesis System (TaKaRa, Dalian, China). SYBR Green PCR Master mix (TaKaRa, Dalian, China) was used to perform the Real-time PCR.
An Applied Biosystems 7500 Real-time Polymerase Chain Reaction (RT-PCR) system was used to analyze the subunit EBI3 and p35 of IL-35. The following primers were employed in each reaction: EBI3, forward 5′-GGCAAGTAGCAAG GGCTTC-3′ and reverse 5′-AGTCGGTCATCTGAGGTTGC-3′; p35, forward 5′-TCCTCCTTGAAGAACCGGA-3′ and reverse 5′-TGA CAACGGTTTGGAGGGAC-3′. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as the control: forward 5′-CAGGAGGCCATTGCTGATGAT-3′ and reverse 5′-GAAGGCTGGGGCTCATTT-3′. The thermal cycling conditions are described as follows: Following an initial denaturation step at 95 °C for 30 s, 40 cycles of profile were carried out: 95 °C, 5 s; 60 °C, 34 s. Relative transcripts were determined by the formular: 2^{−(CTtarget-CTcontrol)}.

Total DNA of soil aggregate-size fraction samples was extracted from 0.25 g equivalent dry soil using the PowerSoil^® DNA Isolation Kit (MO BIO Laboratories Inc., Carlsbad, CA, United States). The extracted DNA was qualified by gel electrophoresis and quantified using a NanoDrop 2000 spectrophotometer (Thermo Scientific, MA, United States) and then stored at −70°C prior to molecular assays. Quantification of bacterial 16S rDNA and fungal 18S rDNA was performed on a 7500 real-time polymerase chain reaction (PCR) system (Applied Biosystems, United States) using SYBR^® Premix Ex Taq™ II kit (TAKARA). Specifically, universal primer pairs of 338F (ACTCCTACGGGAGGCAGCAG)/518R(ATTACCGCGGCTG CTGG) (Fierer et al., 2005 (link)) and NS1F (GTAGTCATATGCT TGTCTC)/FungR (ATTCCCCGTTACCCGTTG) (May et al., 2001 (link)) were used to target bacterial 16S and fungal 18S rRNA genes, respectively. The quantitative PCR conditions included an initial denaturation at 95°C for 5 min, followed by denaturation at 95°C for 45 s for 35 cycles, and annealing at 56°C for bacteria and 57°C for fungi for 30 s, respectively. Standard curves were generated with triplicated 10-fold dilution series of plasmids with the corresponding target genes. The R² of each standard curve exceeded 0.99, and each PCR efficiency was between 90 and 110%.