Nucleospin extract 2 columns

GNAQ, GNA11 and BRAF amplicons were attained from UM by PCR using Sybr green premixture (Bio-Rad, Veenendaal, Netherlands). The following protocol was used for amplification of exon 5 of the GNA11 and the GNAQ genes:
94°C, 3min; (96°C, 15sec; 63°C, 15sec; 72°C, 1min) 7X; (96°C, 15sec; 61°C, 15sec; 71°C, 1min) 8X; (96°C, 15sec; 60°C, 15sec; 72°C, 1min), 36X; 72°C, 1min, end. For amplification of exon 15 of BRAF the following protocol was used:
94°C, 3min; (96°C, 15sec; 60°C, 15sec; 72°C, 30sec) 40X; 72°C, 1min, end.
The primers used in PCR consisted of:
CGCTGTGTCCTTTCAGGATGGTG, GNA11ex5FGCCCACCTAGTTGTCCGACT, GNA11ex5RCCCTAAGTTTGTAAGTAGTGCTATATTTATGTTG, GNAQex5FATGATAATCCATTGCCTGTCTAAAGAACAC, GNAQex5RAACTCTTCATAATGCTTGCTCTGATAGG, BRAFex15FGCCTCAATTCTTACCATCCACAAAATG, BRAFex15RAfter amplification, DNA clean-up was performed using the Nucleospin Extract II columns of Macherey-Nagel (Düren, Germany) following the manufacturer’s instructions. For sequencing analysis, samples were prepared by adding 10 pmol of the forward or the reverse primer to the purified DNA amplicon. Sequencing for mutations was performed at the Leiden Genomic Technology Center (LGTC) of the LUMC.

Various reagents used in this study were purchased from the following suppliers: IQ supermix, and Agarose from Bio-Rad; DNA purification Kit using Nucleospin Extract II columns from Machery Nagel, Germany (Cat no. 740609-50); T4 Kinase Polynucleotide from Invitrogen; γ-³²P- ATP from Amersham (3000 Ci/mmol); SSDNA from Sigma Aldrich cat# D7656; Sephadex columns from GE Healthcare (Microspin G-25 column illustra 27-5325-01); and T4-Kinase from Invitrogen, Life Technology.
DNA concentration was quantified using the Gene Quant Spectrophotometer. PCR was performed using My Cycler Thermal Cycler from Bio-Rad; Membrane hybridization and crosslinking were carried out using ProBlot 12 Hybridization Oven Labnet, (31 Mayfield Avenue Edison, NJ, 08837 USA), and Spectrolinker UV Crosslinkers from Krackeler Scientific, (Inc. PO Box 1849 Albany, NY 12201-1849), respectively. Sequencing of purified DNA was carried out at the University of Saint Joseph, Department of Molecular Biology and Genetics using the Avant Genetic Analyzer (ABI 3130) machine. The sequencing reaction and subsequent purification steps were as described before [9] (link).

For validation of the GNAQ and GNA11 mutation status, as acquired by dPCR, Sanger sequencing was performed on all 66 UM DNA samples by PCR using a Sybr green premixture from Bio-Rad Laboratories, Inc. Primers used are summarized in S2 Table, and the following PCR protocol was used for amplification of exon 4 and exon 5 of GNAQ and GNA11 genes: 94°C, 3min; (96°C, 15sec; 63°C, 15sec; 72°C, 1min) 7x; (96°C, 15sec; 61°C, 15sec; 71°C, 1min) 8x; (96°C, 15sec; 60°C, 15sec; 72°C, 1min) 36x;72°C, 1min; till end. Following amplification DNA clean-up was performed using Nucleospin Extract II columns (Machery-Nagel, Düren, Germany) according to the manufacturer’s instruction. For Sanger sequencing analysis 10 pmol of the forward or reverse primer was added to the purified DNA amplicon. Sequencing for mutations was outsourced (Baseclear, Leiden, Netherlands). In UM samples showing no mutation in exon 5 of GNAQ or GNA11 the exon 4 mutation status of both genes was determined (method identical to exon 5), primers are summarized in S2 Table. We used Mutation Surveyor software (Softgenetics, State College, USA) to assist mutation analysis.