Total rna kit 1

The expressions of inflammatory transcripts were determined with qPCR performed on Light cycler 480 (Roche).¹⁷ Following indicated treatments, the total RNA was isolated with an E.Z.N.A. Total RNA kit 1 (Omega Bio‐Tek). DNAse contamination was removed using a RNAse‐free DNA Removal Kit (Omega Bio‐Tek) based on the manufacturer's instructions. cDNA was synthesized using a cDNA synthesis kit (Roche). qPCR was performed using the primers mentioned below. The levels of respective genes relative to the GAPDH were analysed, and the ∆ΔCT values were calculated and expressed as relative expression or fold change compared to control (no template). The quality of the RNA, primers and qPCR reaction was validated using proper controls, like no RT control or no template control.
Primers.mMIP1β‐ F: 5’‐TCTCTCTCCTCTTGCTCGT‐3′; R: 5’‐CCGGGAGGTGTAAGAGAAAC‐3’
mMCP‐1‐ F: 5’‐AGTAGGCTGGAGAGCTACAA‐3′; R: 5’‐GTATGTCTGGACCCATTCCTT‐3’
mTNFα‐ F: 5’‐CTATGTCTCAGCCTCTTCTCATTC‐3′; R: 5’‐GAGGCCATTTGGGAACTTCT‐3’
mCOX‐2‐ F: 5’‐AACCGCATTGCCTCTGAAT‐3′; R: 5’‐CATGTTCCAGGAGGATGGAG‐3’.
mCOX‐1‐ F: 5’‐GGATACTGGCTCTGGGAATTTG‐3′; R: 5’‐GTAGTCATGCGCTGAGTTGTAG‐3’
mGAPDH‐ F: 5’‐CTCCCACTCTTCCACCTTCG‐3′; R: 5’‐CCACCACCCTGTTGCTGTAG‐3’

Total RNA was extracted using E.Z.N.A. Total RNA Kit 1 (Omega Biotek) and 1 μg RNA was reverse transcribed into cDNA by using iScript cDNA synthesis kit (Bio-Rad) according to manufecturer’s protocol. The cDNA was diluted 10-fold and qRT-PCR analysis was performed using iTaq Universal SYBR Green Supermix (Bio-Rad). Gene expression levels were analysed in a CFX96 Real-Time PCR Detection System (Bio-Rad) and normalized based on β-actin mRNA expression. Primer sequences used in qRT-PCR are indicated in supplementary Table 4.

Total RNA was isolated from cultured HUVEC using the E.Z.N.A. Total RNA kit 1 (R6834-02, Omega Bio-Tek) according to the manufacturer’s instructions. RNA quantity measurements were performed using the ND1000 Spectrophotometer (Saveen Werner) and RNA was stored at -80°C until further analysis. A quantity of 250 ng RNA was reverse transcribed in a total volume of 20 μl using the “High capacity RNA-to-cDNA kit” (cat no 4387406, Applied Biosystems). Quantitative Real-time PCR (qRT-PCR) was performed on an ABI Prism 7900HT (Applied Biosystems) using Taq Man Gene Expression Master Mix (4369016, Applied Biosystems) and predesigned TaqMan Gene Expression Assays as listed in Table 2. 60S ribosomal protein L30 (RPL30) was used as endogenous control. The Ct cutoff value was set to 40 cycles, and the relative mRNA level for each transcript was calculated by the ∆∆Ct method [30 (link)]. Briefly, the cycle threshold (Ct) values for each gene was normalized against the Ct values of the housekeeping gene (= ∆Ct). For comparison of gene expression in treated versus control cells, ∆∆Ct was calculated as ∆Ct in treated cells subtracted the ∆Ct for control cells. The fold change in mRNA expression was calculated as 2^-∆∆Ct.

RNA was extracted using the TRIzol/RNeasy method (Qiagen Sciences, Valencia, CA, USA). Briefly, approximately 20 mg of frozen muscle was added to Lysing Matrix D tubes (MP Biomedicals, Solon, OH, USA), containing 1 mL of TRIzol Reagent (Life Technologies, Burlington, ON, Canada). Muscle samples were homogenized using the FastPrep-24 Tissue and Cell Homogenizer (MP Biomedicals, Solon, OH, USA) for 40 sec at a setting of 6 m/sec. 200 µl of chloroform reagent was added to homogenized samples (Sigma-Aldrich, Oakville, ON, CA), mixed for 15 sec, incubated at room temperature for 5 minutes and centrifuged for 10 minutes at 12000 g at 4°C. The aqueous phase was transferred to a new tube and equal amounts of 70% ethanol was added and mixed. The mixture was transferred into an RNeasy mini-spin column and RNA was purified following the commercially available E.Z.N.A. Total RNA Kit 1 (Omega Bio-Tek, Norcross, GA, USA) as per manufacturer’s instructions. The RNA concentration and purity was quantified using the Nano-Drop 1000 spectrophotometer (Thermo Fisher Scientific, Rockville, MD, USA). RNA integrity was assessed using a bioanalyzer (Agilent 2100 Bioanalyzer; Agilent Technologies). Average RNA Integrity Number (RIN) values were 6.4.

Total RNA was extracted using E.Z.N.A. Total RNA Kit 1 (Omega BIO-TEK, USA), and PCR analysis was performed using the NovoStart® SYBR qPCR SuperMix Plus (Novoprotein, China). The 2^−ΔΔCT method was used to analyze the relative mRNA expression in comparison to the reference gene GAPDH. The primer sequences for amplifying COMP and ADAMTS7 and internal control GAPDH were as follows: COMP (F: 5′-CGTGCGGCCCCTGCTCCACTGCG -3′, R: ACCTGCTTGTTGGCCTTGGCGAAGCCA-3′); ADAMTS7 (F: 5′-TCAGTGCTCAGTGACATGTGGGGA-3, R: 5′-CGTTGAAGAGCTCGTGGCTGGA-3′); GAPDH (F: 5′-GGAGCGAGATCCCTCCAAAAT-3′, R: 5′-GGCTGTTGTCATACTTCTCATGC-3′).

Total RNA was extracted from the IVD cells using Total RNA Kit 1 (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using Rotor-Gene Q (Qiagen, Valencia, CA, USA). A validated primer pair for DUSP-1 (HA212233) was purchased from Takara (Shiga, Japan), and those for NGF (QT00001589) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (QT01192646) were purchased from Qiagen. Expression levels of the genes of interest were calculated and expressed as the difference relative to the housekeeping gene GAPDH, using the delta-delta Ct (threshold cycles) method.