Abi 7500 analyzer

The total RNA was extract and purified by the TRIzol method. Synthesis of cDNA and real-time quantitative PCR (qRT-PCR) measurements were performed as described previously [21 (link)]. The pre-designed primer sequences for qRT-PCR analysis were as following:
Cathepsin K (CTSK): 5′-GGAAGAAGACTCACCAGAAGC-3′ (forward) and 5′-GTC-ATATAGCCGCCTCCACAG-3′ (reverse); Matrix metalloproteinase-9 (MMP-9):5′-CC-TGTGTGTTCCCGTTCATCT-3′ (forward) and 5′-ACCCGAATCTAGTAAGGTCGC-3′ (reverse); TRAP: 5′-GCTGGAAACCATGATCACCT-3′ (forward) and 5′-TTGAGCCAGG-ACAGCTGAGT-3′ (reverse); Atg7, 5′-GTTCGCCCCCTTTAATAGTGC-3′ (forward) and 5′-TGAACTCCAACGTCAAGCGG-3′ (reverse); Atg5, 5′-ATGCGGTTGAGG-CTCACTTTA-3′ (forward) and 5′-GGTTGATGGCCCAAAACTGG-3′ (reverse); BECN1: 5′-CTAAGGCAGGCAGGAGGATG-3′ (forward) and 5′-GCTGGCCTCAA-GAGATCCAT − 3′ (reverse); Cyclophillin A: 5′-CGAGCTCTGAGCACTGGAGA-3′ (forward) and 5′-TGG-CGTGTAAAGTCACCACC-3′ (reverse).
qRT-PCR analysis was carried out by SYBR Premix Ex TaqTM kit and using ABI7500 analyzer (Thermo, MA, USA).

We extracted total RNA from the ankle joints of pGIA or control mice using the ISOGEN (Wako Pure Chemical Industries, Tokyo, Japan) extraction method according to the instructions provided by the manufacturer. The extracted RNA was reverse-transcribed to complementary DNA with random primers. We performed real-time qPCR using a TaqMan gene expression assay (Applied Biosystems/Thermo Fisher Scientific, Foster City, CA, USA), and the Padi4 (Mm01341658_m1) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (NM_002046) primers. Real-time qPCR was carried out using an ABI 7500 analyzer (Applied Biosystems). The expression of GAPDH was used as the control.

At the time of study enrollment, venous blood samples (4 mL) for genotyping were taken into Vacuette K3EDTA anticoagulant test tubes (Greiner Bio-One, Kremsmünster, Austria) and stored at −80 °C. The manufacturer’s protocol for DNA isolation was followed (MagMAXTM DNA Multi-Sample Ultra 2.0 Kit, Thermo Fisher, Waltham, MA, USA), performed on a King Fisher Flex analyzer, and analysed by competitive allele-specific PCR (KASP-PCR) on the ABI 7500 analyzer (Applied Biosystems, Waltham, MA, USA USA); according to the finished reaction, a signal was read by the end-point method. Specific primers for the COMT polymorphism rs4689 were commercially prepared by LGC Biotechnologies (LGC Genomics, Teddington, UK). The KASP-PCR method was used for rs4689 COMT genotyping. According to the genotype, the wild-type homozygote (Val/Val) was defined as GG, the mutant homozygote (Met/Met) was defined as AA, and the mutant heterozygote (Val/Met) was defined as GA.

At the time of study enrollment, venous blood samples (4 mL) for genotyping were taken into Vacuette K3EDTA anticoagulant test tubes (Greiner Bio-One, Kremsmünster, Austria) and stored at −80 °C. The manufacturer’s protocol for DNA isolation was followed (MagMAXTM DNA Multi-Sample Ultra 2.0 Kit, Thermo Fisher, Waltham, MA, USA), performed on a King Fisher Flex analyzer, and analysed by competitive allele-specific PCR (KASP-PCR) on the ABI 7500 analyzer (Applied Biosystems, Waltham, MA, USA USA); according to the finished reaction, a signal was read by the end-point method. Specific primers for the COMT polymorphism rs4689 were commercially prepared by LGC Biotechnologies (LGC Genomics, Teddington, UK). The KASP-PCR method was used for rs4689 COMT genotyping. According to the genotype, the wild-type homozygote (Val/Val) was defined as GG, the mutant homozygote (Met/Met) was defined as AA, and the mutant heterozygote (Val/Met) was defined as GA.

For both research models, gene expression analysis of ESR1 and ESR2 was performed in a manner similar to the previous work [69 (link)]. In this paper, we briefly describe the research techniques used.
To perform qRT-PCR analysis, mRNA isolation was performed from the obtained material. The RNeasy Lipid Tissue Mini Kit (Qiagen, Hilden, Germany) was used for the tumor areas of the GBM tumor and the RNeasy Mini Kit (Qiagen, Hilden, Germany) for the cell culture material. The concentration and purity of the obtained isolate were checked using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). In a further step, the mRNA was transcribed into cDNA using Reverse Transcription PCR. qRT-PCR analysis was performed using a Power SYBR Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) and an ABI 7500 analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) (95° C (15 s), 40 cycles of 95 °C (15 s) and 60 °C (60 s)). The following primer sequences were used: ESR1: CCCACTCAACAGCGTGTCTC |CGTCGATTATCTGAATTTGGCCT, ESR2: AGATTCCCGGCTTTGTGGAG |GAGCAAAGATGAGCTTGCCG. The expression level of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was selected as an endogenous control. The method was performed in the same way as described in the work by Simińska et al., where it is described in more detail [69 (link)].