Guava easycyte 6 2l bench cytometer

The day before transfection, Hepa1-6 cells were plated in 24 well plates at a density of 90 000 cells per well. Cells were transfected with 500 ng of LentiCrispR V2 (Addgene plasmid #52961) containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT) using Lipofectamine 2000 (11668027, Life Technologies). Puromycin selection was carried out 36 h after transfection using a 5 µg/ml solution (ant-pr-1, InvivoGen). Cells were exposed to puromycin for 48 h, then washed and expanded for two weeks in DMEM complete medium before analysis. Immunostaining was performed using the rat monoclonal antibody MT81 to label mouse CD81^{11 (link)}. All incubations were performed at 4 °C for one hour. We used a 2 µg/ml final concentration of Alexa Fluor 488-conjugated Goat anti-rat antibody (A1106, Life technologies) as a secondary antibody. Cells were then fixed with 1% (w/v) formaldehyde solution and analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).

For immunolabeling of EphA2 and CD81, cells were harvested using an enzyme-free Cell Dissociation buffer (Life Technologies), and either directly processed for surface labeling of EphA2 and/or CD81, or treated with the Perm/Fix solution (BD Biosciences) for total labeling of surface and intracellular EphA2. We used the anti-EphA2 rabbit monoclonal antibody D4A2 (#6997, Cell signaling technology, diluted 1/200) and the anti-CD81 mouse monoclonal antibody MT81 (10 μg/ml) [21 (link)]. All incubations were performed at 4°C during one hour. After labeling with fluorescent secondary antibodies, cells were analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with a 488 nm and 532 nm lasers (Millipore).

Hepa1-6 cells were seeded in 96 well plates (2 × 10⁴ per well seeded the day before transfection) and incubated with 1 × 10⁴ PbGFP sporozoites for 3 h, washed, and further cultured until 24 h post-infection. HepG2 and HepG2/CD81, plated in 96 well plates with 3 × 10⁴ cells per well seeded the day before infection, were infected using 5 × 10³ PbGFP sporozoites. In some experiments, anti-mouse CD81 MT81 at 20 µg/ml^{11 (link)} was added to the cultures at the same time as sporozoites, and the mix was incubated for 3 h before washing the cells with fresh medium. After 24 h, infected cultures were either trypsinized for detection of GFP-positive cells by flow cytometry or fixed with 4% (w/v) paraformaldehyde for fluorescence microscopy. Flow cytometry was performed on a Guava EasyCyte 6/2L bench cytometer (Millipore), and a total of 10,000 cells was analyzed for each sample. For fluorescence microscopy, infected cultures were labeled with polyclonal goat antibodies specific for UIS4 (Sicgen) used at 2 µg/ml, secondary Alexa Fluor 594-conjugated Donkey anti-goat antibodies (A11058, Life technologies) at 2 µg/ml, and the nuclear stain Hoechst 33342. The total number of UIS4-positive EEFs was counted in each well.