Real-time PCR was performed using Takara SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2×) on a CFX96 Real-Time PCR Detection System. The reaction volume was 25 μL, containing 12.5 μL of Takara SYBR® Premix Ex Taq II (Tli RNaseH Plus) (2×), 1 μL of each primer and 2 μL of the cDNA template. Amplification conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 64°C (55°C for GAPDH) for 30 s. SYBR® Green PCR mix and primers that were specific to our target gene were used to efficiently amplify the target region. The primers used were as follows: GAPDH sense: 5′-GCACCACCAACTGCTTAGCAC-3′; GAPDH antisense: 5′-TCTTCTGGGTGGCAGTGATG-3′; FOLR2 sense: 5′-ACTTCTGCTGCTTCTGGTCT-3′; FOLR2 antisense: 5′-GTCATGCAGCTTGTCCTCAG-3′.
Sybr premix ex taq 2 tli rnaseh plus
Manufactured by Takara Bio
Sourced in Japan, China, United States, Germany, Switzerland, Singapore, Canada
SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) is a ready-to-use real-time PCR master mix. It contains SYBR® Green I dye, Ex Taq™ DNA Polymerase, and Tli RNaseH Plus for sensitive and specific detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (135 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (94 mentions)
Primescript rt reagent kit, by Takara Bio (84 mentions)
Primescript rt master mix, by Takara Bio (47 mentions)
Trizol, by Thermo Fisher Scientific (46 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (31 mentions)
Rneasy mini kit, by Qiagen (30 mentions)
Primescript rt reagent kit with gdna eraser perfect real time, by Takara Bio (18 mentions)
Rnaiso plus reagent, by Takara Bio (18 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (17 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (17 mentions)
Rnaiso plus, by Takara Bio (16 mentions)
Lightcycler 480, by Roche (16 mentions)
Trizol reagent, by Takara Bio (15 mentions)
Thermal cycler dice real time system, by Takara Bio (13 mentions)
Primescript rt reagent kit perfect real time, by Takara Bio (13 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (12 mentions)
Gdna eraser, by Takara Bio (12 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (12 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (11 mentions)
644 protocols using sybr premix ex taq 2 tli rnaseh plus
1
Real-Time PCR Analysis of FOLR2 Expression
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For both the control and Cd treated plantlets, fresh root tip (about 0.5 cm ) tissues were collected after 5 d of growth as described above, and flash frozen in liquid nitrogen prior to storage at -80 ℃. Total RNA was isolated and purified using RNA isolation and clean up kits (EZ-10 DNAaway RNA Mini-prep Kit, Sagon). First-strand cDNA was synthesized from 2μg of total RNA using a PrimeScript TM 1st strand cDNA Synthesis Kit (TaKaRa) according to the manufacturer's instructions. qRT-PCR analysis was done using 20μL reaction mixtures containing 20 ng of template cDNA, 0.5μM of corresponding forward and reverse primers and 10μL of 2×SYBR Mix (SYBR ® Premix Ex Taq TM Ⅱ (Tli RNaseH Plus, TaKaRa). Reactions were run and analyzed on the iCycler iQ (Bio-Rad) according to the manufacturer's instructions. The specificity of amplification products was determined by melting curves. ACT2 was used for signals normalization. IQ5 relative quantification software (Bio-Rad) automatically calculates relative expression level of the selected genes with algorithms based on the 2 -△△Ct method (Livak and Schmittgen, 2001) . Data were from triplicates and are representative of at least three biological replicates. The sequence of primers used in this study is provided in Supplementary Table S1.
3
Tissue Distribution of Elovl mRNA in S. constricta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue distribution of the newly cloned S. constricta Elovl mRNA was analyzed by quantitative real-time PCR (qPCR). Adult specimens (n = 18) of S. constricta (55.23 ± 3.31 mm × 17.82 ± 1.21 mm, shell length × shell width, mean ± SD) were purchased from a local market in Ningbo, China. After acclimation for 3 days to allow evacuation of the intestinal tract, total RNA was extracted from 10 tissues including mantle, labial palps, inhalant siphon, exhalant siphon, foot muscle, intestine, gill, digestive glands, gonad and heart. Each tissue was sampled from six individuals and pooled, and triplicate samples prepared. One μg of total RNA was reverse transcribed to cDNA using PrimeScript TM RT Master Mix (Perfect Real Time, TaKaRa). The qPCR was conducted on a quantitative thermal cycler (Mastercycler ep realplex, Eppendorf, Germany) using SYBR ® Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (TaKaRa) (Table S1) and primers as shown in Table 1. Both β-actin and 18S rRNA were selected as reference genes (Table 1). The relative expression of S. constricta Elovl was calculated by the 2 - ΔΔCT method [38] , and presented as the geometric means of qRT-PCR results derived from the expression of the two reference genes. Expression of candidate Elovl genes in all tissues were calculated in relation to that of foot muscle, which showed the lowest expression level among all tissues considered.
4
Validating RNA-seq Differential Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To check the reliability of RNA-seq, nine DEGs were randomly selected to perform qRT-PCR verification, including transcription factor AP-2 epsilon (tfap2e), MAF BZIP transcription factor K (mafk), proline-rich transmembrane protein 1 (prrt1), adenylate cyclase 7 (adcy7), Rho-associated protein kinase 2 (rock2), oligodendrocyte transcription factor 2 (olig2), WD repeat domain 5
(wdr5), cAMP-regulated phosphoprotein 19 (arpp19), and WD repeat domain 1 (wdr1). The primers for qRT-PCR are shown in Table S1. The qRT-PCR was performed using SYBR Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (Takara, Shiga, Japan) according to the manufacturer's instructions. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. All samples were run with triplicate. The relative expression levels were calculated according to the 2 -△△Ct method. Statistical significance was determined by one-way analysis of variance (ANOVA). Significance was set at p < 0.05.
(wdr5), cAMP-regulated phosphoprotein 19 (arpp19), and WD repeat domain 1 (wdr1). The primers for qRT-PCR are shown in Table S1. The qRT-PCR was performed using SYBR Premix Ex Taq TM Ⅱ (Tli RNaseH Plus) (Takara, Shiga, Japan) according to the manufacturer's instructions. The PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. All samples were run with triplicate. The relative expression levels were calculated according to the 2 -△△Ct method. Statistical significance was determined by one-way analysis of variance (ANOVA). Significance was set at p < 0.05.
5
Quantitative Real-time PCR Analysis of ABCA1, COL6A1, and GSTT1L
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative Real-time PCR (Q-PCR) was used to measure the mRNA expression levels of the ABCA1, COL6A1, and GSTT1L genes. Total RNA was extracted from the breast muscle tissues using the TRIzol reagent (Invitrogen) and was further purified with RNeasy columns (Qiagen) according to the manufacturer’s protocol. The primers for the Q-PCR were designed using online software Primer3plus82 (link) (http://primer3.sourceforge.net/webif.php ) and were synthesized by Sangon biotech Co., Ltd. (Shanghai, China) (Supplementary Table S5 ). Each of the RNA samples was diluted to 1000 ng/uL. The cDNA was synthesized using the primeScriptTM RT reagent kit (Takara). Q-PCR was performed using SYBR® Premix Ex TaqII (Takara) on the LightCycler® 96 Real-Time PCR system (Roche Applied Science) in a 10-uL reaction volume containing 1 μL cDNA, 5 μL 2× SYBR®Premix Ex Taq™ II (TliRNaseH Plus) (TaKaRa), 0.5 μL each of forward and reverse primers (10 μM), and 3 μL RNase-Free Water. All of the data were normalized to the expression level of actin. The Q-PCR amplification procedure was as follows: 95 °C for 3 min; 35 cycles of 95 °C for 30 s; 60 °C for 30 s; 72 °C for 20 s; and an extension for 10 min at 72 °C. All of the Q-PCR reactions were performed in triplicate. The 2−ΔΔCt method was used to determine the relative mRNA abundance83 (link).
6
RT-qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of total RNA was treated with DNase-I (TaKaRa Bio Inc., Japan) and subjected for cDNA synthesizing using the PrimeScript™ RT reagent Kit (TaKaRa Bio Inc., Japan). RT-qPCR was performed with a LightCycler system (iQ5, Bio-Rad, USA). Each reaction was performed in a total 20 μl reaction system containing 10 μl 2 × SYBR® Premix Ex Taq™II(Tli RNaseH Plus, TaKaRa Bio Inc., Japan), 2 μl cDNA, 0.8 μl of each primer (10 μM) and 6.4 μl of nuclease-free water. RT-qPCR primers were designed using PerlPrimer (http://perlprimer.sourceforge.net/ ) software across intron/exon boundaries. Primer sequences are listed in Additional file 5 and β-actin gene was included as a housekeeping gene. Moreover, melting curve analysis was performed after real-time PCR reactions to monitor PCR product specificity. At least three biological replicates were performed for each sample. Relative fold change was analyzed according to the 2-△△Ct method against housekeeping gene (β-actin).
7
Quantitative PCR for Dehalococcoides genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR (qPCR) reactions were performed to quantify the copy number of the 16S rRNA gene, tceA gene, and vcrA gene in Dehalococcoides spp. using the primers Dhc.16S-f: AAGGCGGTTTTCTAGGTTGTCAC and Dhc.16S-r: CGTTTCGCGGGGCAGTCT for the quantification of the 16S rRNA gene, tceA-f: GCCACGAATGGCTCACATA and tceA-r: TAATCGTATACCAAGGCCCG for the quantification of the tceA gene, and vcrA-f: TGCTGGTGGCGTTGGTGCTCT and vcrA-r: TGCCCGTCAAAAGTGGTAAAG for the quantification of the vcrA gene on a CFX96™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Each qPCR master mix consisted of 12.5 μL 2×SYBR® Premix Ex Taq™ II (Tli RNaseH Plus, TAKARA), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 2 μL DNA extract and 8.5 μL PCR grade water. The thermocycling conditions were as follows: 95 °C for 30 s (initial denaturation), 95 °C for 5 s (denaturation), 60 °C for 30 s (annealing), 40 cycles of 95 °C for 15 s, 60 °C for 55 s (elongation), and 0.5 °C s−1 to 95 °C (melting curve). All qPCR were performed in three replicates.
8
Quantifying Gut Microbiome Composition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Marker loci gene copies for total bacteria, total Methanogens, the genus Prevotella, Fibrobacter succinogenes, Ruminococcus albus, and Ruminococcus flavefaciens were enumerated by quantitative PCR on a QuantStudio 6 Flex Real-Time PCR System (Thermo Scientific, Rockford, IL, USA) using SYBR Green as the fluorescent dye. The primers and reaction conditions were selected on the basis of a careful review of published literature (Table S2 ). The standard curves were generated from diluting plasmid DNA (10-fold serial dilution) that contained the cloned marker loci. Each reaction contained 5 μL of 2 × SYBR Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Bio Inc., Shiga, Japan), 1 μL of each primer (10 μM), 0.2 μL of Rox (Takara Bio), 80 ng of microbial DNA, and 2.3 μL of deionized water. Thermal cycling was performed at 95°C for 30 s, followed by 40 cycles of 95°C for 15 s, annealing for 30–60 s (annealing temperatures and times are shown in Table S2 ), and collection of fluorescent signals. All samples were prepared from the heifers and each sample was assayed in triplicate. All obtained standard curves met the required standards of efficiency (R2 > 0.99, 110% > E > 90%). Results were expressed as the log10 transfer of numbers of marker loci gene copies per gram of feces (wet weight).
9
Expression Analysis of Immune Regulators in Perianal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from perianal tissues was enriched through TRIzol reagent (TaKaRa Biotechnology Co., Ltd., Dalian, China) and then reversely transcribed into cDNA by PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (TaKaRa) following the operating instruction. RT-qPCR was performed in a 25 μl quantum involving 2 μl of the cDNA, 12.5 μl 2 × SYBR® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa), 2 μl of the 10-μM upstream and downstream primers as well as 8.5 μl ddH2O, using the ABI PrismTM 7500 (Thermo Fisher). The RT-qPCR conditions were as follows: 30 s at 95°C, followed by 40 cycles between 95°C for 5 s and 60°C for 30 s, 95°C for 10 s, and 65°C for 5 s. The relative expressions of T-bet, RORγt, GATA3, and Foxp3 were calculated using the 2−ΔΔCT method and normalized to the GAPDH. All the primers used in the present study were listed in Table 2 .
10
Quantitative RT-PCR for miR-663a Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To conduct the quantitative reverse transcription PCR (RT-qPCR) for the detection of miR-663a expression level, complementary DNA (cDNA) synthesis from miRNA was performed using miRCURY LNA™ Universal RT microRNA PCR Starter Kit (EXIQON, Vedbaek, Denmark), according to manufacturer’s instructions. Then, real-time PCR amplification was performed in a 10 μL solution containing PCR master mix, PCR primer mix (EXIQON, product no: 204284), and cDNA template. Similarly, cDNA synthesis from total RNA was carried out using PrimeScript™ II 1st strand cDNA Synthesis Kit (TaKaRa Bio, Shiga, Japan) and RT-PCR was performed in a 12.5 μL solution containing 2 × SYBR Premix Ex Taq II (Tli RNaseH Plus, TaKaRa Bio), 1 μL cDNA, and 0.4 μM of each primer. The sequences of the primers are available in Additional file 1 : Table S1). Each RT-qPCR assay was performed in triplicate using the Thermal Cycler Dice Real Time System Single (TaKaRa Bio). Relative expression levels were calculated by the ΔΔCt method. The expression levels of target genes such as miR-663a and other genes were normalized to U6 and GAPDH, respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!