Siglo green

Genetran (Biomiga) was used to transfect HEK239T cells with miR-34c-minigene and pCDNA3-AblPPn plasmid DNA (Tu et al., 2015 (link)). Transfected cells and their media (for EV isolation) were collected 24 h after transfections. RNAiMAX was used to transfect MEFs with control mimic (CGGUACGAUCGCGGCGGGAUAUC) and miR-34c mimic (AGGCAGUGUAGUUAGCUGAUUGC) (Sigma). The transfection efficiency was ∼80%, as determined by siGLO green (Dharmacon). The ROS levels in live transfected cells were measured at 24 h posttransfection as described above.

PC-3 cells were stained with fluorescence nuclear staining (Hoechst nuclei stain; 2.6 µg/ml; Invitrogen; Thermo Fisher Scientific, Inc.) for 10 min at 37°C. The adherent cell cytometry system, Celigo^® (analyzed by Application Programing Interface, version 1.0, software), allowed rapid quantification of cellular fluorescence expression as previously described (21 (link)). siGLO Green Transfection Indicator (50 nM, Dharmacon Inc., Lafayette, CO, USA) was transfected into PC-3cells with DharmaFECT 1 (0.15 µg/100 µl well, Dharmacon Inc.). After 24 h, cells were washed with 1X PBS and stained with Hoechst nuclei stain (2.6 µg/ml; Invitrogen; Thermo Fisher Scientific, Inc.). Plates were analyzed using the adherent cell cytometer equipped with bright field and fluorescent channels: A blue 4′,6-diamidino-2-phenylindole filter for the Hoechst nuclei stain and a green filter for the siGLOGreen (Dharmacon Inc.). Gating parameters were adjusted for each fluorescence channel to exclude background and other non-specific signals. The Celigo^® system provided a gross quantitative analysis for each fluorescence channel and individual well, including total count and average integrated red fluorescence intensity of gated events.