Total RNA was isolated with Trizol (Invitrogen, USA) according to the manufacturer's instructions. cDNA synthesis for miRNAs was performed by using the miR‐Amp kit (Parsgenome, Iran) in poly (A) tailing manner. The expression levels of miRNAs were assessed through SYBR green method and monitored by ABI PRISM 7500 instrument (Applied Biosystems, USA). As a reference gene, U6 snRNA was used for normalization of miRNAs expression. cDNA synthesis for Sirt1 and BCL2 was done by PrimeScript™ RT reagent Kit (Takara, Japan) using random hexamer primers. RT‐qPCR was done on ABI PRISM 7500 instrument (Applied Biosystems) using specific primer pairs. The forward (F) and reverse (R) primers for the specific amplification of Sirt1 were, F: 5' AAGGAGCAGATTAGTAAGC 3' and R: 5' TAGAGGATAAGGCGTCAT 3'. The primer pairs for BCL2 were F: 5' ACTTCTCTCGTCGCTACCGTC 3' and R: 5' AAGAGTTCCTCCACCACCGT 3'. The primer pairs for Gapdh were F: 5' TGCCGCCTGGAGAAACC 3' and R: 5' TGAAGTCGCAGGAGACAACC 3' (Macrogen Company, South Korea). The relative expression of target genes was normalized by Glyceraldehyde 3‐phosphate dehydrogenase (Gapdh) as a reference gene. All reactions were performed in triplicate. Real‐time data were analyzed based on 2−ΔΔCT method.
Abi prism 7500
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, Germany, United Kingdom, Switzerland, Austria, Canada, Australia
The ABI Prism 7500 is a real-time PCR system designed for gene expression analysis and quantification. It features a 96-well format and can perform up to 50 cycles of PCR reactions. The system includes a thermal cycler and an optical detection module to monitor the fluorescence signals generated during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (246 mentions)
Trizol, by Thermo Fisher Scientific (87 mentions)
Rneasy mini kit, by Qiagen (75 mentions)
Primescript rt reagent kit, by Takara Bio (49 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (37 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (36 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (36 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (32 mentions)
Sybr green master mix, by Thermo Fisher Scientific (29 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (28 mentions)
Rneasy kit, by Qiagen (23 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (22 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (21 mentions)
High capacity cdna archive kit, by Thermo Fisher Scientific (19 mentions)
Sybr premix ex taq, by Takara Bio (18 mentions)
Dnase 1, by Thermo Fisher Scientific (18 mentions)
Superscript 3, by Thermo Fisher Scientific (15 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (15 mentions)
Sybr premix ex taq 2, by Takara Bio (15 mentions)
Sybr green, by Thermo Fisher Scientific (13 mentions)
1 009 protocols using abi prism 7500
1
Gene Expression Analysis of miRNAs, Sirt1, and Bcl2
2
Quantification of miR-145-5p gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol Reagent (Invitrogen), following the manufacturer’s protocol and was reverse transcribed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems). Quantification of gene expression was measured by Sybr Green assay (Applied Biosystems, Carlsbad, CA, USA) on Abi Prism 7500 (Applied Biosystems). cDNA reverse transcriptase of miR-145-5p was performed using miScript II RT kit (Qiagen, Chatsworth, CA). Quantification of miR-145-5p was carried out by miScript SYBR Green PCR kit (Qiagen, Chatsworth, CA), using miScript Primer Assay: Hs_miR-145_1 (miScript Primer Assay MS00003528 Qiagen, Chatsworth, CA), and Hs_RNU6_B (miScript Primer Assay MS00033740 Qiagen, Chatsworth, CA) as normalizer, on Abi Prism 7500 (Applied Biosystems). All reactions were performed in duplicates.
3
Quantitative Analysis of Bx-cpl Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expressions of Bx-cpls were analyzed using real-time quantitative PCR (qPCR). Total RNA was extracted from 3000 nematodes at each developmental stage and mixed stages using Trizol reagent (Invitrogen, Waltham, MA, USA). The RNA quantity and integrity were checked as previously described. The cDNA was synthesized using TransScript II One-Step gDNA Removal and cDNA Synthesis SuperMix following the manufacturer’s protocol (TransGen Biotech, Beijing, China). Specific primers were designed from the cDNA sequence of target genes using Primer Premier 5.0 (Table 2 ). The actin gene was amplified as a reference gene using the primers Actin-F/Actin-R (Table 2 ). The qPCR was performed on ABI Prism 7500 (Applied Biosystems, Foster City, CA, USA) using SYBR Green Master Mix (Vazyme, Nanjing, China). The initial data analysis was performed using ABI Prism 7500 software (https://www.thermofisher.com/cn/zh/home/technical-resources/software-downloads/applied-biosystems-7500-fast-real-time-pcr-system.html ) and the 2−ΔΔCt method. All experiments were performed in triplicate with three biological replicates.
4
Quantitative Gene and miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the TRIZOL Reagent (GIBCO). 500 ng of total RNA were reverse-transcribed using High-Capacity RNA-to-cDNA Kit (Applied Biosystems) and diluted 1:5 for PCR reactions. PCR analyses were carried out by using oligonucleotides specific for the genes listed in Supplementary Table 1 and gene expression was measured by real-time PCR using the Sybr Green assay (Applied Biosystems, Carlsbad, CA, USA) on Abi Prism 7500 (Applied Biosystems). All reactions were performed in duplicate.
RNA from FFPE samples was extracted using the miRneasy FFPE kit (Qiagen, Chatsworth, CA) following the manufacturer’s instructions. 50 ng of total RNA was reverse transcribed in 20 μl by using miScript II RT kit (Qiagen, Chatsworth, CA) and 1 μl of cDNA dilution (1:5) was used for quantitative real-time PCR (RT-qPCR) experiments. Quantification of miR-145-5p was carried out by miScript Primer Assay (Hs_miR-145_1 miScript Primer Assay MS00003528 Qiagen, Chatsworth, CA), normalizing over RNU6B control (Hs_RNU6-2_11 miScript Primer Assay MS00033740 Qiagen, Chatsworth, CA) and using the miScript SYBR Green PCR kit (Qiagen, Chatsworth, CA) on Abi Prism 7500 (Applied Biosystems). All reactions were performed in duplicate.
RNA from FFPE samples was extracted using the miRneasy FFPE kit (Qiagen, Chatsworth, CA) following the manufacturer’s instructions. 50 ng of total RNA was reverse transcribed in 20 μl by using miScript II RT kit (Qiagen, Chatsworth, CA) and 1 μl of cDNA dilution (1:5) was used for quantitative real-time PCR (RT-qPCR) experiments. Quantification of miR-145-5p was carried out by miScript Primer Assay (Hs_miR-145_1 miScript Primer Assay MS00003528 Qiagen, Chatsworth, CA), normalizing over RNU6B control (Hs_RNU6-2_11 miScript Primer Assay MS00033740 Qiagen, Chatsworth, CA) and using the miScript SYBR Green PCR kit (Qiagen, Chatsworth, CA) on Abi Prism 7500 (Applied Biosystems). All reactions were performed in duplicate.
5
Quantitative Expression Analysis of miRNA and Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis for miR-141 and miR-200a was achieved by using a “universal cDNA synthesis kit” (Exiqon, Denmark) in a poly A tailing method, as stated by manufacturer. Real-time quantitative PCR (RT-qPCR) reactions were performed using standard protocol with an ABI PRISM 7500 instrument (Applied Biosystems, USA); cDNA products were added to a master mix comprising 10 pmol/μl of each miR-141 or miR-200a DNA primers (Exeqon, Denmark) and 2 U of SYBR premix ExTaq II (TaKaRa, Japan), similar to our previous study [14 (link)]. RNU48 small nucleolar RNA was quantified as the reference to normalize differences in total RNA levels. cDNA synthesis for IL-17A, IL-23R, RORC, TGF-β, FOXP3, SMAD2, GATA3 and FOXO3 was carried out on a total RNA which has reverse-transcribed by RevertAid First Strand cDNA synthesis Kit (Thermo Scientific, USA) using random hexamer primers. RT-qPCR was carried out using specific primer pairs in ABI PRISM 7500 instrument (Applied Biosystems, USA). The expression level of these genes was normalized by 18srRNA as reference gene. All reactions were carried out in triplicate. Real-time data were evaluated and reported based on ΔΔCT method.
6
Quantitative Analysis of Wound Healing Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA samples were prepared from the wound skins obtained at 3, 5, 7, 9, 13, and 17 d after injury. Then, the cDNA of each sample was synthesized by a RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) from 2 μg of RNA. The relative mRNA expression was determined by qRT-PCR according to the THUNDERBIRD™ SYBR qPCR Mix (TOYOBO, Japan) in a total 30 μL volume. Next, qRT-PCR was performed on ABI PRISM 7500 (Applied Biosystems, CA, USA). The primer sequences are described in Table 1 . Each cycle consists of activation at 95°C for 10 min, 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s to the platform stage, followed by 72°C for 10 min. Each sample was performed in triplicate. β-actin was chosen as the internal control gene. The relative gene expression was calculated using ABI PRISM 7500 version 2.0.6 software (Applied Biosystems, CA, USA) with the 2−ΔΔCt method.
7
Quantitative analysis of miR-34a and BCL-2 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Synthesis of cDNA for miR‐34a was performed using a “universal cDNA synthesis kit” (Exiqon, Denmark) based on a poly A tailing method, as specified by the manufacturer. Real‐time quantitative PCR (RT‐qPCR) products were conducted according to the standard protocols in an ABI PRISM 7,500 instrument (Applied Biosystems, USA). cDNA product was added to a master mix comprising 10 pmol/µl of miR‐34a predesigned primers (Exeqon, Denmark) and 2 U of SYBR premix ExTaq II (TaKaRa, Japan) (Naghavian et al., 2015 ). The expression level of the RNU6 small nucleolar RNA was also evaluated as a reference miRNA to normalize the results. cDNA synthesis of BCL‐2 was conducted using the Revert Aid First Strand cDNA Synthesis Kit (TaKaRa, Japan), by utilizing the random hexamer primers. RT‐qPCR was performed using specific primer pairs in the ABI PRISM 7,500 instrument (Applied Biosystems, USA). The expression levels of BCL‐2 were normalized with GAPDH as the reference gene. All reactions were implemented in triplicate. RT‐qPCR primers for BCL‐2 and GAPDH are listed in Table 1 .
8
Validation of mRNA Expression Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five mRNAs, including matrix metallopeptidase 11 (MMP-11; ENSG00000099953), dual specificity phosphatase 1 (DUSP1; ENSG00000120129), Fos proto-oncogene, AP-1 transcription factor subunit (FOS; ENSG00000170345), serpin family E member 1 (SERPINE1; ENSG00000106366), and adenosine deaminase 2 (ADA2; ENSG00000093072) were selected for validation analysis, and GAPDH served as an mRNA endogenous control. The primers are presented in Table I . cDNA synthesis was conducted using a RevertAid™ First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). The relative mRNA expression was determined by RT-qPCR according to the THUNDERBIRD™ SYBR qPCR Mix (Toyobo, Co., Ltd., Osaka, Japan). qRT-PCR was performed on an ABI PRISM 7500 (Applied Biosystems; Thermo Fisher Scientific, Inc.). The relative gene expression was calculated using ABI PRISM 7500 version 2.0.6 software (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the 2−ΔΔCq method (11 (link)).
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. A total of 1 μg RNA was used as a template for single-strand cDNA synthesis using oligo(dT) primers and TransScript®RT/RI Enzyme Mix (TransGen Biotech, Beijing, China). The resulting cDNA was amplified with TransStart® Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) on an ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA), programmed for 94°C for 30 s, followed by 40 cycles of 94°C for 5 s and 60°C for 30 s. Amplification results were analyzed with the ABI Prism 7500 software (Applied Biosystems), and expression levels of the genes of interest were normalized to the corresponding Gapdh results. The primer sequences are presented in Table 1 .
10
Detecting STS Gene Copy Numbers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As 90% of the patients with XLI have large deletions involving the entire STS gene, the copy numbers of this gene were directly detected by quantitative PCR on genomic DNA. Primers were designed using the Primer Express 3.0 software (Applied Biosystems, Thermo Fisher Scientific, Inc., Waltham, MA, USA). The STS primers used were as follows: STS-E1F, 5′-GTTGCCCCTTCTGAAGAATCC-3′; STS-E1R, 5′-GAGGCGGAGACACTC TTTGC-3′; STS-E10F, 5′-TGGAGTGCAGTGGTGCAATC-3′; STS-E10R, 5′-GTGACTTGGGAGGCTGAAGTG-3′. The quantitative PCR was conducted using the ABI Prism 7500 sequence detection system (Applied Biosystems, Thermo Fisher Scientific Inc.) as described by Wilke et al (11 (link)). Data were analyzed using the ABI 7500 Prism sequence detection software (Applied Biosystems, Thermo Fisher Scientific, Inc.). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control gene for gene copy number analysis. The 2−ΔΔCq method for relative quantification was used to evaluate STS gene copy numbers of the patient and his parents in comparison with those of healthy controls. DNA from healthy controls served as a calibrator that had a 2−ΔΔCq of 1. The 2−ΔΔCq value of the inspected sample is the ratio of the target gene copy number of inspected sample to the calibrator.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!