Gfx pcr dna and gel band purification kit

Constructs made for this study are listed on Supplementary Table S2. Transcription-translation fusions with the gfp gene were constructed by PCR in a pHT315 vector (Lanigan-Gerdes et al., 2007 (link)) containing gfp (pHT315-gfp). The vector was linearized using appropriate restriction enzymes (NEB) and purified after agarose gel electrophoresis using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare). Insert fragments were amplified with Q5 DNA polymerase (NEB) by PCR with the appropriate primer pairs listed on Supplementary Table S3. The resulting fragments were digested with the appropriate restriction enzymes, purified after agarose gel electrophoresis using the GFX™ PCR DNA and Gel Band Purification Kit (GE Healthcare) and ligated into the linearized pHT315-gfp vector. Plasmid constructs were transformed into chemically competent E. coli DH5-α cells through heat shock. Once confirmed by DNA sequencing, all vectors were transformed into the non-methylating E. coli ET12567 strain by electroporation (Supplementary Materials and Methods). Vectors amplified by E. coli ET12567 were purified and transformed into B. cereus strains using electroporation (Supplementary Materials and Methods).

Samples of genomic DNA were isolated according to a procedure previously reported by Medeiros and colleagues [44 ] and subjected to PCR to isolate Rex1 sequences. PCR assays were performed using the primers RTX1-F1 (TTCTCCAGTGCCTTCAACACC) and RTX1-R3 (TCCCTCAGCAGAAAGAGTCTGCTC) [9 ], which are specific for isolating a region of the gene encoding the RT (ORF 2) of the TE Rex1. The products of these reactions were analyzed after electrophoresis in a 1 % agarose gel. Bands corresponding to fragments of approximately 550 bp were observed in each case. For Physalaemus albonotatus, an additional band of fragments of approximately 350 bp was obtained. All of these bands were cut from the gel with sterile blades, and the DNA fragments were purified with the GFX PCR and Gel Band DNA Purification kit (GE Healthcare).

To generate data for the genetic distance, phylogenetic, and species delimitation
analyses, sequences of the H1 mitochondrial DNA (that comprise the 12S rRNA,
Val-tRNA, and 16S rRNA genes) were obtained by PCR using the primer pairs MVZ 59
(Graybeal, 1997 )/Titus I (Titus and Larson, 1996 ) and 12L13 (Feller and Hedges, 1998 )/16Sbr (Palumbi et al., 2002 ). The amplified
products were electrophoresed in 1% agarose gels and then purified using the GFX
PCR and Gel Band DNA Purification kit (GE Healthcare) according to the
manufacturer’s instructions. The samples were sequenced using the BigDye
Terminator kit (Applied Biosystems), with the primers MVZ 59, MVZ 50 (Graybeal, 1997 ), 12L13 (Feller and Hedges, 1998 ), Titus I (Titus and Larson, 1996 ), 16L2a, 16H10
(Hedges, 1994 ), 16sAR, and 16sBR
(Palumbi et al.,
2002).
The products of the sequencing reactions were purified by precipitation in 80%
ethanol and centrifugation at 1,200 rpm for 30 minutes, and were then washed in
70% ethanol and centrifuged for 10 minutes. Once dried, the products were
resuspended in loading dye (Blue-Dextran-EDTA/Formamide, 1:5), denatured for 3
minutes at 94 °C, and then transferred to automatic sequencer. The sequences
were edited using the Bioedit software, available at
http://www.jwbrown.mbio.ncsu.edu/BioEdit/bioedit.html (Hall, 1999 ).