Nucleotide triphosphates

All experiments were carried out in HiFi buffer [50 mM tris-HCl (pH 7.5), 70 mM NH₄Cl, 30 mM KCl, 3.5 mM MgCl₂, 8 mM putrescine, and 0.5 mM spermidine) (3 (link)). Chemicals were from Roche Molecular Biochemicals, Sigma-Aldrich, or Merck, and nucleotide triphosphates were from Jena Bioscience. Radioactive compounds were from Hartmann Analytic. Total Escherichia coli tRNA was from Roche Molecular Biochemicals. EF-Tu, initiation factors, [³H]Met-tRNA^fMet, f[³H]Met-tRNA^fMet, and BODIPY-[³H]Met-tRNA^fMet were prepared from E. coli as described (3 (link)). Site-directed mutagenesis of the gene 60 construct (29 (link)) was performed using the QuickChange polymerase chain reaction (PCR) protocol (3 (link)). The sequence of the SecM mRNA construct was ATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGAATATCAACACTGGTTACGTGAAGCAATAAGCCAACTTCAGGCGAGCGAAAGCCCGCGGCGTGATGCTGAAATCCTGCTGGAACATGTTACCGGCAAAGGGCGTACTTTTATCCTCGCCTTTGGTGAAACGCAGCTGACTGACGAACAATGTCAGCAACTTGATGCGCTACTGACACGTCGTCGCGATGGTGAACCCATTGCTCATTTAACCGGGGTGCGAGAATTCTGGTCGTTGCCGTTATTCAGCACGCCCGTCTGGATAAGCCAGGCGCAAGGCATCCGTGCTGGCCCTATGTCCGGTAAAATGACTGGTATCGTAAAATGGTTCAACGCTGACAAAGGCTTCGGCTTCATCACTCCT. mRNAs were produced by T7 RNA polymerase in vitro transcription and purified by ion exchange chromatography on a HiTrap Q HP 5-ml column (GE Healthcare).

All experiments were carried out in HiFi buffer [50 mM tris-HCl (pH 7.5), 70 mM NH₄Cl, 30 mM KCl, 3.5 mM MgCl₂, 8 mM putrescine, and 0.5 mM spermidine] (34 (link)). Biochemicals were from Merck, and nucleotide triphosphates were from Jena Bioscience. [³H]methionine and [¹⁴C]leucine were from Hartmann Analytics. Bodipy-FL-succinimidyl ester was from Invitrogen. Total E. coli tRNA was from Roche, and oligonucleotides were from IBA. 70S ribosomes, EF-Tu, EF-G, IF1, IF2, IF3, [³H]Met-tRNA^fMet, and f[³H]Met-tRNA^fMet were prepared from E. coli (35 (link)–37 (link)). Site-directed mutagenesis of the WT gene 60 construct (9 (link)) was performed using the QuikChange polymerase chain reaction protocol with the appropriate oligonucleotide primers. mRNAs were produced by T7 RNA polymerase in vitro transcription and purified by ion-exchange chromatography on a HiTrap Q HP 5-ml column (GE Healthcare). Fluorescence-labeled [³H]Met-tRNA^fMet (Bpy-Met-tRNA^fMet) was prepared, as previously described (38 (link)), with modifications (39 (link)).