Sybr premix ex taq 2 perfect real time kit

Expression profiles of the wheat genes were determined by quantitative real-time PCR analysis. cDNAs for all of studied genes were amplified using primers designed from known wheat nucleotide sequences (Supplementary Table 1). The wheat β-actin gene (GeneBank accession number AB181991) was used as the reference gene. Amplification products for each primer set were cloned and sequenced to ensure the gene identities. Quantitative real-time RT-PCR analysis was performed on an Applied Biosystems LightCycler 7300 system using the SYBR Premix Ex Taq II (Perfect Real-Time) Kit (Takara). The cycling conditions were as follows: 95°C for 5 min, followed by 40 cycles of 95°C for 5 s and the optimal annealing temperature of 60°C for 30 s. The specificity of the PCR amplification in each reaction was checked with a melting curve analysis (from 55 to 94°C) following the final cycle of amplification.

Total RNA was isolated from tissues and cell lines using the miRNeasy Mini Kit (Qiagen). The miRNA Q-PCR Detection Kit (GeneCopoeia) was used for quantification of miRNA levels according to the manufacturer’s protocol. The protocol was conducted for 35 cycles at 95 °C for 3 min, 95 °C for 12 s, and 58 °C for 30 s. The PCR amplification for the quantification of the miR-186 and U6 was performed using TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and TaqMan Human MiRNA Assay Kit (Applied Biosystems, Foster City, CA, USA). The relative expression of miR-186 was shown as fold difference relative to U6. The PCR amplification for the quantification of the NSBP1 and GAPDH mRNAs was performed using an ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) and a SYBR®Premix Ex Taq™ ii (Perfect Real Time) Kit (Takara Bio, Shiga, Japan). The primers were as follows: miR-186: 5′- GCGGCGCAAAGAATTCTCCT-3′; miR-186 mimics, forward primer: 5′-GCGGCGCAAAGAATTCTCCT-3′ and reverse primer: 5′-GTGCAGGGTCCGAGGT-3′; NSBP1, forward primer: 5′-TCGGCTTTTTTTCTGCTGACTAA-3 and reverse primer: 5′-CTCTTTGGCTCCTGCCTCAT-3′. β-actin, forward primer: 5′- CATTAAGGAGAAGCTGTGCT-3′ and reverse primer: 5′- GTTGAAGGTAGTTTCGTGGA -3′.