Brilliant 2 sybr green qrt pcr master kit

Total RNA was extracted as described [44] (link), using RNAqueous-4-PCR (Life Technologies) and subsequently treated with Turbo-DNAase (Life Technologies) according to the manufacturer's instructions. Two step qRT-PCR was employed to measure RNAi knockdown. First-Strand cDNA was synthesized using the SMARTer cDNA synthesis kit (Clontech, Mt. View, CA) and amplified using the Brilliant II SYBR green qRT-PCR Master kit (Agilent Technologies, Santa Clara, CA) on an Applied Biosystems 3500 Genetic Analyzer according to the manufacturer's recommendations (omitting the cDNA synthesis step). Primers used for the amplification of SMDR2, SmMRP1 and 18S ribosomal RNA have been described previously [43] (link), [44] (link). Primers used for amplification of ABCA4 (Smp_056290) were: ABCA4-Sy1 (5′- GGGTGGTATGACAACAGCAA -3′) and ABCA4-Sy2 (5′- GAGCTGAAATTGGCCCTCTA -3′). Primers used for amplification of ABCB6 (Smp_134890) were: ABCB6-Sy1 (5′- TGCTATTGCCGCTGACATAC -3′) and ABCB6-Sy2 (5′- CCAATGCTGATGTAGCTTCG -3′). Primers used for amplification of MRP7 (Smp_147250) were: MRP7-Sy1 (5′- AGCTGGTGGGAGCAGTCTTA -3′) and MRP7-Sy2 (5′- ATCCAACTGGTGTGTGACGA -3′). Data were analyzed using the 2^−ΔΔC_t method [83] (link) to determine the relative expression ratio between target (transporters) and reference genes (18S RNA).

Real-time RT-PCR was used to measure levels of knockdown by RNAi. Total S. mansoni RNA was extracted from adult worms using Direct-Zol RNA Mini Prep (ZYMO Research, Irvine, CA) according to the manufacturer's instructions. qRT-PCR was performed using the Brilliant II SYBR green qRT-PCR Master kit (Agilent Technologies, Santa Clara, CA) on an Applied Biosystems 7500 according to the manufacturer's recommendations and as described [62 (link)]. Primers used for the amplification of 18S ribosomal RNA have been described [62 (link)]. Primers used for amplification of SmTRPA1 were: TRPA FWDSET1 (5′-TCGTCTTGGAGCAAATCCTAAT-3′) and TRPA REVSET1 (5′-CTGGTAGGACTGTTCTGATTCC-3′). Primers used for amplification of SmTRPM7 were: TRPM7 FWDSET1 (5′-GAGAACCCAGTCCAGGTTTAAG-3′) and TRPM7 REVSET1 (5′-GCTAACATCGGTCGTATCCATT-3′). Data were analyzed using the 2^−ΔΔC_t method [65 (link)] to determine the relative expression ratio between targets (TRP channels) and reference genes (18S RNA).