Tet plko puro

Manufactured by Addgene

Sourced in United States

The Tet-pLKO-puro is a lentiviral plasmid vector that can be used to create inducible knockdown cell lines. It contains a puromycin resistance cassette and a tetracycline-inducible promoter that can be used to control the expression of a short hairpin RNA (shRNA) targeting a gene of interest.

Automatically generated - may contain errors

Lab products found in correlation

Doxycycline dox, by Merck Group (8 mentions) Cshrna, by Merck Group (7 mentions) Pinducer20, by Addgene (6 mentions) Pspax2, by Addgene (4 mentions) Plko 1 puro, by Addgene (4 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions) Puromycin, by Merck Group (4 mentions) Doxycycline, by Merck Group (3 mentions) Pmd2 g, by Addgene (3 mentions) Plko puro, by Addgene (3 mentions) Lenticrispr v2 vector, by Addgene (3 mentions) Polybrene, by Santa Cruz Biotechnology (2 mentions) Plko 1, by Addgene (2 mentions) Lenti x concentrator, by Takara Bio (2 mentions) Plko 1 trc cloning vector, by Addgene (2 mentions) Klenow dna polymerase, by New England Biolabs (2 mentions) Tet plko puro, by New England Biolabs (2 mentions) T4 ligase, by New England Biolabs (2 mentions) Superscript 3 first strand kit, by Thermo Fisher Scientific (2 mentions) Pcdna3 flag crbn, by Addgene (2 mentions)

71 protocols using tet plko puro

Generation of CD24 knockdown cell lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CD24 cDNA (CCDS75499.1) was cloned into pLVX-puro (Takara). shRNA oligonucleotides targeting CD24 or nontargeting control oligonucleotides were cloned into Tet-pLKO-puro (a gift from Dmitri Wiederschain, Addgene plasmid #21915) [54] (link) according to the published protocol (Addgene). Lenti-X 293T cells (Takara) were transfected using FuGENE 6 reagent (Promega) with pMD2.G and psPAX2 packaging plasmids (gifts from Didier Trono, Addgene #12259 and #12260, respectively), and pLVX-puro-CD24, empty pLVX-puro vector, Tet-pLKO-puro-shCD24 or Tet-pLKO-puro-shNTC. Lentiviral particles were purified from filtered supernatant using Lenti-X Concentrator (Takara), and the viral pellet was resuspended in fresh Neurocult medium for two 12-hr transductions on consecutive days. Transduced cells were selected with puromycin. Dox dosage was titrated, and the optimal dose of 100 ng/mL was used. shRNA sequences:

Name	Target sequence (sense)
shNTC	CAACAAGATGAAGAGCACCAA
shCD24_3	GCAGTCAACAGCCAGTCTCTT
shCD24_5	CTTCTGCATCTCTACTCTTAA

Haddock S., Alban T.J., Turcan Ş., Husic H., Rosiek E., Ma X., Wang Y., Bale T., Desrichard A., Makarov V., Monette S., Wu W., Gardner R., Manova K., Boire A, & Chan T.A. (2022). Phenotypic and molecular states of IDH1 mutation-induced CD24-positive glioma stem-like cells. Neoplasia (New York, N.Y.), 28, 100790.

+ Open protocol

+ Expand

TP63 Silencing in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To silence TP63 in human cells, two previously verified shRNA vectors were used by respectively targeting all TP63 isoforms (shRNA-1) and specifically targeting only ΔNp63α isoform (shRNA-2)^{28 (link)}. In murine cell lines and mouse models, a tetracycline-inducible shRNA-expressing vector-Tet-pLKO-puro (Addgene, #21915) was used (Supplementary Table 1). Synthesized forward and reversed oligos were annealed to be double-stranded oligonucleotide shRNAs and then cloned into the AgeI/EcoRI sites of the pLKO.1-TRC (Addgene #10878) or Tet-pLKO-puro vector. pcDNA3.1/hygro and deltaNp63alpha-FLAG (Addgene, # 26979) plasmids were purchased from Addgene (Supplementary Table 1). The siRNA, shRNA, and primer sequences were listed in Supplementary Table 2.

Jiang Y., Zheng Y., Zhang Y.W., Kong S., Dong J., Wang F., Ziman B., Gery S., Hao J.J., Zhou D., Zhou J., Ho A.S., Sinha U.K., Chen J., Zhang S., Yin C., Wei D.D., Hazawa M., Pan H., Lu Z., Wei W.Q., Wang M.R., Koeffler H.P., Lin D.C, & Jiang Y.Y. (2024). Reciprocal inhibition between TP63 and STAT1 regulates anti-tumor immune response through interferon-γ signaling in squamous cancer. Nature Communications, 15, 2484.

+ Open protocol

+ Expand

Generating Inducible VCP Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

A doxycycline‐inducible shRNA‐expressing vector and lentivirus packaging plasmids were obtained through Addgene (Watertown, MA, USA); Tet‐pLKO‐puro was a gift from Dmitri Wiederschain (Addgene plasmid #21915, Immuno‐Oncology Research, Sanofi, Boston, MA, USA) and psPAX2 and pMD2.G were gifts from Didier Trono (Addgene plasmids #12260 and #12259, Laboratory of Virology and Genetics, Swiss Federal Institute of Technology in Lausanne, Lausanne, Switzerland). Each of four shRNA oligos targeting VCP (shVCP #1, #2, #4, #5) and one non‐targeting oligo (control shRNA) were cloned into Tet‐pLKO‐puro (Data S1). Lentiviruses were produced in HEK293T cells according to Addgene's protocol. Stable cell lines were generated by lentiviral infection. Condensed lentiviral solution was added to KMS11 and KMS12PE cells with 8 μg/mL polybrene (Sigma‐Aldrich, St Louis, MO, USA). Cells were cultured with 1 μg/mL puromycin (Wako Pure Chemical Corp., Osaka, Japan) from 48 hours after infection. For the induction of shRNAs, doxycycline (Sigma‐Aldrich) was added to a concentration of 1 μg/mL in the culture medium.

Nishimura N., Radwan M.O., Amano M., Endo S., Fujii E., Hayashi H., Ueno S., Ueno N., Tatetsu H., Hata H., Okamoto Y., Otsuka M., Mitsuya H., Matsuoka M, & Okuno Y. (2019). Novel p97/VCP inhibitor induces endoplasmic reticulum stress and apoptosis in both bortezomib‐sensitive and ‐resistant multiple myeloma cells. Cancer Science, 110(10), 3275-3287.

+ Open protocol

+ Expand

Lentiviral Modulation of YWHAZ and BECN1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tet‐pLKO‐puro (Addgene) and Psico‐GFP (Addgene) lentiviral vector systems were used to mediate the RNA interference (RNAi) of YWHAZ (14‐3‐3ζ) and BECN1 (beclin 1), respectively. Plv‐EF1a‐IRES‐neo lentiviral vector system (Addgene) was utilized to mediate the overexpression of 14‐3‐3ζ. Short hairpin sequences (shRNA) were as follows: YWHAZ‐(F)‐5'ccggcccaaaggagattactaccgttttcaagagaaacggtagtaatctcctttttttt 3', YWHAZ‐(R)‐5'aattaaaaaaaaggagattactaccgtttctcttgaaaacggtagtaatctcctttttttt3';
BECN1‐(F)‐5'tggacaacaagtttgaccatgcttcaagagagcatggtcaaacttgttgtccttttttc3',
BECN1‐(R)‐5'tcgagaaaaaaggacaacaagtttgaccatgctctcttgaagcatggtcaaacttgttgtcca3'. Lentiviral particles were packaged in HEK 293T cells, namely n.c. oe‐LV, 14‐3‐3ζ oe‐LV, n.c. sh‐LV, 14‐3‐3ζ sh‐LV and beclin 1 sh‐LV (n.c., negative control; oe, overexpression). Lentiviral particles of MOI = 20 were used to infect HCC cancer cells.

Tang Y., Zhang Y., Liu S., Sun Z., Wang C., Li L., Zhou W, & Cheng S. (2019). 14‐3‐3ζ binds to and stabilizes phospho‐beclin 1S295 and induces autophagy in hepatocellular carcinoma cells. Journal of Cellular and Molecular Medicine, 24(1), 954-964.

+ Open protocol

+ Expand

CRISPR Knockout of D2HGDH and L2HGDH in Lymphoma

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

CRISPR-Cas9 technology was used to knockout (KO) the D2HGDH and/or L2HGDH genes in P493-6, OCI-Ly1 and OCI-Ly8 cell lines. In single gene KOs, the lentiCRISPR v2 puromycin was used(Sanjana et al., 2014 (link)). For double D2HGDH/L2HGDH KO, a combination of lentiCRISPR v2 puromycin and pL-CRISPR.EFS.GFP(Heckl et al., 2014 ) was used. lentiCRISPR v2 was a gift from Feng Zhang (Addgene plasmid # 52961); pL-CRISPR.EFS.GFP was a gift from Benjamin Ebert (Addgene plasmid # 57818). ShRNA-mediated MYC knockdown was implemented with Tet-pLKO-puro, a gift from Dmitri Wiederschain (Addgene plasmid # 21915)(Wiederschain et al., 2009 (link)); virus generation was performed, as we previously described(Kim et al., 2011 (link)). In brief, HEK-293T cells were co-transfected with the lentiCRISPR v2 (or pL-CRISPR.EFS.GFP) and the packing and envelop plasmids PAX2 and pMD2.G, respectively (Addgene #s 12260 and 12259). Cells supernatant was collected at 48h and 72h, and lymphoma cell lines transduced by spinoculation, followed by polyclonal population selection and/or clone generation by limiting dilution, as we reported(Cooney et al., 2018 (link)). D2HGDH and/or L2HGDH knockout was confirmed by western blotting and by Sanger sequencing (in clonal populations). For each gene, at least two distinct guideRNAs or shRNAs were used ( Table S2).

Qiu Z., Lin A.P., Jiang S., Elkashef S.M., Myers J., Srikantan S., Sasi B., Cao J.Z., Godley L.A., Rakheja D., Lyu Y., Zheng S., Madesh M., Shiio Y., Dahia P.L, & Aguiar R.C. (2020). MYC regulation of D2HGDH and L2HGDH influences the epigenome and epitranscriptome. Cell chemical biology, 27(5), 538-550.e7.

+ Open protocol

+ Expand

Inducible Knockdown of SGK1 in Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transduced with lentiviruses encoding shRNAs against SGK1 (from the TRC Genome-Wide shRNA Collection). After preliminary experiments with a battery of previously fully validated clones (9 (link)), shRNA TRCN0000040175 was chosen for subsequent experiments due to its superior targeting efficiency.
ShRNA TRCN0000040175 was cloned into the Tet-pLKO-puro (Addgene plasmid #21915). Lentiviral constructs were packaged in HEK293 cells transfected using Lipofectamine 2000 (Invitrogen). Viral supernatant was collected 48-72 hours after transfection, combined, and filtered using 0.45 μm Nalgene SFCA syringe filters (Thermo Scientific). Target cells were plated 24 hours before infection and then exposed to viral supernatant supplemented with 20 μg/ml polybrene (Santa Cruz). Mouse cell lines were then selected for at least 72 hours with puromycin (Corning) 5 μg/ml, whereas a concentration of 2 μg/ml was used for human cell lines.
Transduced cell lines were pretreated with 250-500 ng/ml doxycycline hyclate for 48 hours prior to plating for growth curve experiments. After seeding, cells were counted every 24 hours and cell number was determined as previously described. In all experiments performed on transduced cell lines, doxycycline hyclate was replaced every 24 hrs.

Orlacchio A., Ranieri M., Brave M., Arciuch V.A., Forde T., De Martino D., Anderson K.E., Hawkins P, & Di Cristofano A. (2017). SGK1 is a critical component of an AKT-independent pathway essential for PI3K-mediated tumor development and maintenance. Cancer research, 77(24), 6914-6926.

+ Open protocol

+ Expand

Lentiviral shRNA Expression for SHP2 Silencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Oligonucleotides for SHP2 shRNA (shRNA#1: 5’ – GTATTGTACCAGAGTATTA – 3’; shRNA#2: 5’ – GGACGTTCATTGTGATTGA – 3’) and control shRNA (5’ – ATCACAGAATCGTCGTATGCA – 3’) were cloned into the lentiviral pLKO.1-puro plasmid (Broad Institute, The RNAi Consortium), and vectors were used to generate U87MG, U118MG, T98G, and LN229 cells expressing shRNA. Identical oligonucleotides were cloned into TET-pLKO-puro (Dr. Dmitri Wiederschain, Addgene plasmid #21915) and used to generate U87MG cells expressing doxycycline-inducible shRNA. Identical oligonucleotides, or a control non-targeting sequence, were cloned into the lentiviral pSicoR-GFP plasmid (Dr. Tyler Jacks) and used to generate G88 and TS528 GSCs expressing shRNA. Unless indicated otherwise, SHP2 shRNA#1 was used. The lentiviral pLKO.1-puro vector expressing HIF-1α shRNA and pCDH-puro vector expressing HIF-1α cDNA were gifts from Dr. Celeste Simon. The pBABE-hygro retroviral vector expressing PTEN was cloned previously (22 (link)) using cDNA provided by Dr. Frank Furnari.

Day E.K., Zhong Q., Purow B, & Lazzara M.J. (2021). Data-driven computational modeling identifies determinants of glioblastoma response to SHP2 inhibition. Cancer research, 81(8), 2056-2070.

+ Open protocol

+ Expand

Quantifying TGF-beta Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA primer sequences used to detect target gene expression by qRT-PCR are listed in Supplementary Table 4. TβRII was amplified by standard PCR with GolddenSatr® T6 Super PCR Mix (TSE101, Tsingke Biotechnology Co., Ltd) and cloned in pEGFP-N1 and pLV-Flag vector. Point mutations were generated by the site-directed mutagenesis with KOD plus (Toyobo) polymerase. All constructs were confirmed by DNA sequencing. shRNAs were obtained from the Sigma Mission Library: TRCN0000294600 for mouse TβRII was subcloned into Tet-pLKO-puro (#21915, Addgene) for DOX inducible knockdown. CHX was from Sigma (C104450); SB431542 was from Millipore (616461); TGF-β (10804) and TβRII-ICD (10358) were from Sino Biological Inc.; GW4869 was from MCE (HY-19363); MG132 was from SelleckChem. CFSE Cell Division Tracker Kit was purchased from Biolgend (# 423801).

Xie F., Zhou X., Su P., Li H., Tu Y., Du J., Pan C., Wei X., Zheng M., Jin K., Miao L., Wang C., Meng X., van Dam H., ten Dijke P., Zhang L, & Zhou F. (2022). Breast cancer cell-derived extracellular vesicles promote CD8+ T cell exhaustion via TGF-β type II receptor signaling. Nature Communications, 13, 4461.

+ Open protocol

+ Expand

Inducible Knockdown of YAP and TAZ in Huh7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

shRNAs of YAP and TAZ were cloned into Tet-pLKO-puro (Addgene 21915). A 10 cm dish of 80% confluent HEK293FT cells was transfected with 10 μg of the transfer plasmid, 5 μg shRNA, 3 μg psPAX2, 2 μg VSV-G and 20 μL of PEI transfection reagent in Optim-MEM without serum. Media was changed after overnight incubation. After 48 h, viral supernatants were filtered through a 0.45 μm low protein binding membrane (Millipore) and used immediately supplied with polybrene. Transduction was performed in Huh7 cells, followed by selection with 2 μg/mL puromycin for 1 weeks. The sequences of shYAP and shTAZ used were:
shYAP: CCGGGCGATGAATCAGCCTCTGAATCTCGAGATTCAGAGGCTGATTCATCGCTTTTT
shTAZ: CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTT

Sun Y., Hu L., Tao Z., Jarugumilli G.K., Erb H., Singh A., Li Q., Cotton J.L., Greninger P., Egan R.K., Tony Ip Y., Benes C.H., Che J., Mao J, & Wu X. (2022). Pharmacological blockade of TEAD–YAP reveals its therapeutic limitation in cancer cells. Nature Communications, 13, 6744.

+ Open protocol

+ Expand

Generation and Functional Characterization of Lentiviral Constructs for CD27-AS1 and miR-224-5p Modulation in AML

Check if the same lab product or an alternative is used in the 5 most similar protocols

The recombinant lentivirus plasmid pFUW (#14882, Addgene, Cambridge, USA) containing full length of CD27-AS1 (LV-CD27-AS1) between the BamHI and HpaI sites was constructed. Lentivirus plasmid Tet-pLKO-puro (#21915, Addgene) was used to achieve CD27-AS1 knockdown by inserting specific short hairpin RNAs (shRNAs) of CD27-AS1 into the region between the AgeI and EcoRI restriction sites: LV-CD27-AS1-Sh1 (target sequence: 5′-GCCTGTGTTCTGTCTCTTA-3′) and LV-CD27-AS1-Sh2 (target sequence: 5′-GCAGAAGGAGATCCGATG-3′). Pre-mir-224 (5′-GGGCTTTCAAGTCACTAGTGGTTCCGTTTAGTAGATGATTGTGCATTGTTTCAAAATGGTGCCCTAGTGACTACAAAGCCC-3′) and miR-224-5p sponge (5′-CTAAACGGAACCACTAGTGACTTGAcgatCTAAACGGAACCACTAGTGACTTGAtcacCTAAACGGAACCACTAGTGACTTGAtttttt-3′) were also ligated into the Tet-pLKO-puro vector to attain miR-224-5p overexpression and knockdown, respectively. Lentivirus plasmid pLVX-IRES-puro overexpressing PBX3 (LV-PBX3) was purchased from Fenghbio (#BR025, Changsha, China). The viral titer for all the lentivirus plasmids was 10⁸ TU/ml. AML cells were infected with relevant lentiviral vectors at a multiplicity of infection (MOI) of 10. Culture medium containing the lentivirus plasmids was replaced with fresh IMDM containing 20% FBS 24 h after incubation. Following functional analysis of the cells were carried out 72 h after infection.

Tao Y., Zhang J., Chen L., Liu X., Yao M, & Zhang H. (2021). LncRNA CD27-AS1 promotes acute myeloid leukemia progression through the miR-224-5p/PBX3 signaling circuit. Cell Death & Disease, 12(6), 510.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!