Rnalater ice

Whole pituitaries were dissected from 10-week-old Dchs2^+/– (control) and Dchs2^–/– (mutant) mice and placed in RNAlater-ice (Thermo Fisher Scientific, AM7030). They were flash-frozen in liquid nitrogen and stored at –80°C. mRNA was extracted using Monarch Total RNA Miniprep kit (New England Biolabs, T2010S) and translated using QuantiTect Reverse Transcription kit (QIAGEN, 205311); then qRT-PCR was performed using QuantiNova SYBR Green RT-PCR kit (QIAGEN, 208152) on a Roche Lightcycler 480. Data were analyzed using ΔΔCT method normalized to housekeeping gene expression; n = 4 pituitaries per genotype. Primers used: Pou1f1 (Pit1) forward CACGGCTCAGAATTCAGTCA, reverse TCCAGAGCATCCTTAGCAGC; Tbx19 (Tpit) forward TGTCTCGCCTGCTTAACGTG, reverse GACAGGGAACATCCGTCTGC; Nr5a1 (Sf1) forward AGCTGCAAGGGCTTCTTCAA, reverse CATTCGATCAGCACGCACAG; Sox2 forward GAGGGCTGGACTGCGAACT, reverse TTTGCACCCCTCCCAATTC; Dchs1 forward TCCACGTTCATCCACTCAGC, reverse GGGGACTGTTCTCACGAAGG; Hprt (housekeeping) forward GTTGGGCTTACCTCACTGCT, reverse TCATCGCTAATCACGACGCT; Actb (housekeeping) forward TTCTTTGCAGCTCCTTCGTT, reverse ATGGAGGGGAATACAGCCC.

To measure expression of genes of interest, total RNA was extracted from cell lines using a PureLink RNA mini kit (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol, including treatment of extracted total RNA with DNase treatment. For RNA extraction from mouse tissues, frozen tissue samples were cut and stored for at least 16 h in RNAlater-Ice (Thermo Fisher Scientific, Waltham, MA, USA) at −20 °C. After tissue transition, total RNA was isolated from the tissue using the mirVana miRNA isolation kit following the manufacturer’s protocol. The DNA-free kit was then used to remove the genomic DNA from the extracted total RNA. Once RNA was extracted using either of these kits, 1 μg RNA was reversed transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) according to the manufacturer’s protocol. RT-PCR was performed as follows: 10 μL of Master Mix (7.5 μL of 2× iQ Supermix; Bio-Rad, Hercules, CA, USA), 1.75 μL of molecular grade water, and 0.75 μL of 20× TaqMan gene expression assay mix (Applied Biosystems, Foster City, CA, USA) were added to 5 μL of diluted (1:25) cDNA. RT-PCR was performed using a C1000 thermal cycler (Bio-Rad, Hercules, CA, USA). All TaqMan assays used were bought from Applied Biosystems. Cyclophilin A (PPIA) and beta-glucuronidase (GUSB) were used as controls.

Brains were cryosectioned at 70 μm, and incubated in RNAlater-ICE (Thermo Fisher Scientific, Melbourne, Australia) at −20 °C overnight. Hippocampi were micro-dissected from sections using an Olympus SZ61 microscope and RNA extracted with ZR-Duet DNA/RNA MiniPrep kit (Zymo Research, Irvine, USA), and treated with DNase I. RNA purity was assessed by NanoDrop ND-1000, quantified using a Qubit 2.0 Fluorometer, and reverse transcribed with Quanta qScript XLT cDNA SuperMix.

Patients with FECD (modified Krachmer grade 5 or 6) requiring corneal transplantation and control participants without guttae (grade 0) were enrolled in a Mayo Clinic Institutional Review Board-approved Hereditary Eye Disease Study. Patients that participated in the study provided written informed consent and agreed to a blood draw and use of their excised central corneal endothelium/Descemet membrane specimen obtained at endothelial keratoplasty for FECD. DNA was isolated from peripheral blood leukocytes and RNA was isolated from corneal endothelium/Descemet membrane specimens following storage in RNAlater ICE (ThermoFisher Scientific, Waltham, MA). This research was conducted in accordance with the Declaration of Helsinki.