SH-SY5Y cells were purchased from Sigma (94030304). SH-SY5Y cells were cultured in DMEM/F12 (Sigma-Aldrich, D6434) supplemented with 10% FBS and 1% P/S and frequently tested for mycoplasma contamination. For neuronal differentiation, the culture medium was changed to DMEM/F12, 2% B27 (Invitrogen, 17504044), 1% P/S, 10 µM all-trans-retinoic acid (Fisher Scientific, 10552611). After 2 days the medium was renewed with fresh all-trans-retinoic acid. At DIV6 the medium was replaced with DMEM/F12, 2% B27, 1% P/S, and 50 ng/ml BDNF (Peprotech EC, 450-02) or 8 nM phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, P8139). Differentiated cells were transduced with WT αSyn-IRES-GFP or IRES-GFP lentiviruses (1 TU/cell) and after 3 days cells were fixed for imaging. For expression analysis, RNA was extracted from differentiated cells non-transfected, or transfected with CMV-hPRNP-mCherry or CMV-hCCR5-mCherry, cDNA was then synthesized and gene expression analysis performed by qPCR.
Sh sy5y cells
Manufactured by Merck Group
Sourced in United States, Italy, Germany, United Kingdom
SH-SY5Y cells are a line of human neuroblastoma cells commonly used in research. They are derived from a metastatic bone tumor and exhibit neuronal characteristics. These cells are frequently employed in the study of neurodegenerative diseases and neurological processes.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (16 mentions)
Sh sy5y cell, by American Type Culture Collection (11 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (9 mentions)
Fetal bovine serum (fbs), by Merck Group (7 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (7 mentions)
Dmem f12, by Thermo Fisher Scientific (7 mentions)
Dmem f12, by Merck Group (6 mentions)
Retinoic acid, by Merck Group (6 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (5 mentions)
Penicillin streptomycin, by Merck Group (4 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (4 mentions)
Sh sy5y cells, by Thermo Fisher Scientific (4 mentions)
Ham s f 12, by Merck Group (3 mentions)
Dulbecco s modified eagle medium, by Thermo Fisher Scientific (3 mentions)
Penicillin, by Thermo Fisher Scientific (3 mentions)
Streptomycin, by Thermo Fisher Scientific (3 mentions)
Dulbecco modified eagle medium (dmem), by Euroclone (2 mentions)
L glutamine, by Euroclone (2 mentions)
6 ohda, by Merck Group (2 mentions)
Penicillin, by Merck Group (2 mentions)
57 protocols using sh sy5y cells
1
Neuronal Differentiation and Transduction of SH-SY5Y Cells
2
SH-SY5Y cell neuronal differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells (ATCC) were cultured in 1:1 EMEM and Hams F12 (Sigma-Aldrich), with 10% FBS (50 ml), 1% non-essential amino acids, 1% 200 mM L-glutamine, 1% penicillin/streptomycin at 37 °C with 5% CO2. SH-SY5Y cells were neuronally-differentiated for 6 days with treatment of 10 μM retinoic acid (RA) (Sigma-Aldrich) as previously described14 (link).
3
Isolation of Biotinylated miRNA Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells purchased from Sigma-Aldrich (Sydney, Australia) were transfected in triplicate with 600 pmoles of single-stranded biotinylated–miR-210-3p mimic (bi-miR-210) (GenePharma, Shanghai, China; 5’CUGUGCGUGUGACAGCGGCUGA–biotin, accession: MIMAT0000267) or bi-miR-239b-5p mimic (Genepharma; 5’UUUGUACUACACAAAAGUACUG–biotin, accession: MIMAT00 00295). Then 150 µL of Dynabeads M-280 streptavidin was prepared for RNA manipulation according to the manufacturer’s directions. Beads were blocked overnight on rotation at 4 °C with 1 mg/mL yeast transfer RNA (tRNA) and 1 mg/mL bovine serum albumin (BSA). After 24 h, cells were trypsinized, spun down, and washed twice in ice-cold phosphate-buffered saline (PBS) before being lysed on ice for 30 min in cell lysis buffer containing 10 mM Tris-HCl (pH 7.5), 10 mM KCl, 1.5 mM MgCl2, 5 mM dithiothreitol (DTT), 0.5% IGEPAL CA-630, 50 U/mL RNase Out, and 1× complete mini-protease inhibitor cocktail (Roche, Sydney, Australia). Blocked beads were washed and resuspended in 450 µL of wash buffer (lysis buffer with NaCl adjusted to 1 M). Lysates were cleared at 5000× g for 5 min at 4 °C, and supernatant was removed and adjusted to 1 M NaCl/450 µL. Cell lysate was incubated with beads on rotation for 30 min at room temperature and subsequently washed 3 times in wash buffer before being resuspended in 250 µL of RNAse/DNase free water.
4
SH-SY5Y Neurotoxicity Exposure Model
5
Neuroprotective Potential of Astragaloside IV in SH-SY5Y Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells purchased from BeNa Culture Collection (Suzhou, Jiangsu, China) were seeded in culture flasks containing complete medium [90% basic Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA, United States), 10% heat inactivated fetal bovine serum, 100 μg/mL streptomycin and 100 U/mL penicillin (Sangon Biotech Co., Ltd, Shanghai, China)] at 37°C and 5% CO2. The medium was refreshed every other day and cells were passaged every 2–3 days. The cells at passage 3 were used for the subsequent experiments.
SH-SY5Y cells in good conditions were treated with different concentrations (10, 50, 100, 150, and 200 μM) of 6-OHDA (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for different time (0, 3, 6, 12, 24, and 48 h) (Chen et al., 2020 (link)). The concentration and time of 6-OHDA intervention at 50% cell activity were selected as the experimental conditions. Different concentrations (25, 50, 100, 150, and 200 μM) of AS-IV (National Institute for the Control of Pharmaceutical and Biological Products, Beijing, China) was added to the medium 2 h before 6-OHDA treatment, or 15 μL JAK2/STAT3 pathway inhibitor SC99 [2-(2-(3-chloro-4-fluorophenyl)hydrazono)-3-(4-chlorophenyl)-3-oxo-propanenitrile, 2-(2-(2-(3-4-fluorophenyl)hydrazine)-3-(4-chlorophenyl)-3-oxo-acrylonitrile)] (15 mM, Sigma-Aldrich) was added to interfere with the pathway (Zhang et al., 2016 (link)).
SH-SY5Y cells in good conditions were treated with different concentrations (10, 50, 100, 150, and 200 μM) of 6-OHDA (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) for different time (0, 3, 6, 12, 24, and 48 h) (Chen et al., 2020 (link)). The concentration and time of 6-OHDA intervention at 50% cell activity were selected as the experimental conditions. Different concentrations (25, 50, 100, 150, and 200 μM) of AS-IV (National Institute for the Control of Pharmaceutical and Biological Products, Beijing, China) was added to the medium 2 h before 6-OHDA treatment, or 15 μL JAK2/STAT3 pathway inhibitor SC99 [2-(2-(3-chloro-4-fluorophenyl)hydrazono)-3-(4-chlorophenyl)-3-oxo-propanenitrile, 2-(2-(2-(3-4-fluorophenyl)hydrazine)-3-(4-chlorophenyl)-3-oxo-acrylonitrile)] (15 mM, Sigma-Aldrich) was added to interfere with the pathway (Zhang et al., 2016 (link)).
6
Neuroblastoma cells transfection PRNP
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human neuroblastoma SH-SY5Y cells (Sigma-Aldrich, Merck Life Science) were cultured and transfected with a plasmid construct encoding human PRNP as previously described (Malachin et al., 2017 (link)). Cells were allowed to grow for 48 h before stress exposure.
7
Internalization of Tau K18 Oligomers in SH-SY5Y Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells were purchased from Sigma Aldrich UK (#94030304) and maintained on 1:1 minimal essential medium (MEM)/F12 Ham medium containing 1% l -Glutamine, 15% foetal bovine serum, and 1% antibiotic antimycotic acid (10,000 units penicillin, 10 mg streptomycin and 25 μg amphotericin B). All reagents were obtained from Sigma Aldrich. Cells between passages two and ten were used for all experiments. The cells were seeded at 200,000 cells/ml in CellView™ Advanced Tissue Culture dishes (#627975, Greiner Bio-One) in the presence of AF-maleimide-labeled tau K18 oligomers dissolved in the culture medium to 5 μM. Following 24 h incubation at 37 °C, 5% CO2, the spent medium was removed, the cells washed with warm PBS and fresh tau-free medium containing 2 μM Hoechst 33342 (#H21492, Molecular Probes) and CellMask Deep Red (1:1000 dilution, #C10046, Thermofisher). Confocal microscopy imaging of internalized tau was performed after 30 min incubation at 37 °C, 5% CO2 using an LSM 710 microscope (Leica).
8
Differentiation of Human Neuroblastoma Cells
9
SH-SY5Y Cells Differentiation and Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SH-SY5Y cells (#94030304, Sigma-Aldrich) were grown in Gibco DMEM supplemented with 10% FBS and 1% P/S. Cells were incubated in a humidified atmosphere at 5% CO2 at 37 °C. For differentiation, plates were coated with collagen G (1:20; L7213, Biochrom) for 2 h, and cells plated at a concentration of 10.526 cells per cm2. The following 4 days cells were incubated in FBS free medium supplemented with 10 µM retinoic acid (R2625, Sigma-Aldrich). After that, cells were incubated in FBS free medium supplemented with 50 ng/ml BDNF (212-GD, R&D Systems). For immunocytochemistry, cells were plated in a 48-well plate, and 0.1 µg of the corresponding DNA was delivered per well along with 1 µl of Lipofectamine 2000, following the manufacturer’s protocol. SH-SY5Y cells were transfected, and live-cell imaged every 30 min for 24 h when evaluating the time-dependent interaction of the BiFC constructs. For quantification of the ratio of BiFC positive cells, SH-SY5Y were fixed 24 h post-transfection.
10
Differentiation of SiMa and SH-SY5Y Neuroblastoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SiMa cells (DSMZ) were grown in RPMI media (Life Technologies) supplemented with 10% Fetal Bovine Serum (FBS) (Life Technologies). SH-SY5Y cells (Sigma) were grown in a 1:1 mix of MEM (Life Technologies) and F12 nutrient mix (Life Technologies) supplemented with 15% FBS and 1% non-essential amino acids (NEAA) (Life Technologies). Cells were maintained at 37°C, 5% CO2. Cell lines were frozen after receiving from supplier and were not used for more than 20 passages (10 weeks).
For differentiation, plates were pre-coated with 10 μg/ml laminin (Sigma) and left at 37°C for at least one hour before washing twice with PBS. SiMa cells were seeded at a density of 1 x104 cells per well in 96-well plates or 2 x104 cells per well in 48-well plates and incubated for 72 hours in differentiation medium (RPMI, 1x B27 (Life Technologies), 1 mM HEPES (Fisher) and 1% NEAA) with or without 10 μM AT-RA (Sigma). SH-SY5Y cells were seeded at 5 x103 cells for 96-well plates and 2 x104 cells for 48-well plates. They were differentiated for 144 hours, using the same differentiation media as SiMa cells, before treatment. 96-well plates with a μClear base (Greiner Bio-one) were used for microscopy.
For differentiation, plates were pre-coated with 10 μg/ml laminin (Sigma) and left at 37°C for at least one hour before washing twice with PBS. SiMa cells were seeded at a density of 1 x104 cells per well in 96-well plates or 2 x104 cells per well in 48-well plates and incubated for 72 hours in differentiation medium (RPMI, 1x B27 (Life Technologies), 1 mM HEPES (Fisher) and 1% NEAA) with or without 10 μM AT-RA (Sigma). SH-SY5Y cells were seeded at 5 x103 cells for 96-well plates and 2 x104 cells for 48-well plates. They were differentiated for 144 hours, using the same differentiation media as SiMa cells, before treatment. 96-well plates with a μClear base (Greiner Bio-one) were used for microscopy.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!