T7 rna polymerase

A DNA fragment containing the full-length BC200 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). The resulting plasmid DNA was linearized using the restriction enzyme XhoI. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology). The products were treated with RNase-free DNase I (Roche) and purified with an RNeasy Mini Kit (Qiagen, MD, USA), with the resulting RNA used for real-time PCR assays. Moreover, the products were treated with Ago2 antibody (#03-110, Sigma-Aldrich) to detect cell lysates utilizing the sample pulled down by biotinylated BC200 and random probe.

The reaction solution for the translation assay contains the highly purified translation system, 30–100 nM of each respective ribosome subunit, 10 µM CM-FDG (Life Technologies), 1.75 U/μl T7 RNA polymerase (Takara, Japan), 3.5 nM DNA fragments containing lacZ, and 1 U/μl RNase Inhibitor (Promega). The solution was incubated at 37 °C and fluorescence was monitored every 10 min for 15 h with Mx3005P (Agilent Technologies). The maximum rate in fluorescence increase was obtained as the index of translation activity. DNA fragments containing E. coli lacZ were prepared by PCR using primers GCGAAATTAATACGACTCACTATAGGG and GGTTATGCTAGTTATTGCTCAGCGG, and pET-lacZ plasmid [14] as template. All experiments were independently carried out three times.

Embryos of different periods were fixed in 4% paraformaldehyde (PFA) solution overnight at 4 °C. After fixation and gradient dehydration, embryos can store at −20 °C for long time. Linearized plasmids were employed as templates to synthesize digoxigenin-labeled antisense probes using the DIG RNA labeling mix (Roche) and T7 RNA Polymerase (TaKaRa). After synthesis, these probes were purified by the RNeasy^® FFPE Kit (Qiagen). Finally, WISH was performed as described using probes including rpl18, gata1, hbae1.1, hbbe1.1, lyz, mpx, p53, p21, and mdm2. The stained embryos were photographed using a microscope (ZEISS, Imager.A1).

The CP-CRP and CRP sequences of GarV-B and GarV-D were amplified from garlic total RNA by RT-PCR using the primers in S1 Table. The PCR products were cloned into the PVX vector between the SalI/ClaI or SalI/XhoI restriction enzyme sites to create recombinant PVXs harboring either CP-CRP or CRP sequence. The CRPs were tagged with FLAG for western blot analysis. The recombinant PVX constructs were then transcribed in vitro using T7 RNA polymerase (Takara) to obtain PVX transcripts to use as inocula. Four-week-old potted plants of N. benthamiana were mechanically inoculated with the PVX transcripts in 0.1 M phosphate buffer. For the construction of a GarV-C infectious clone, the complete cDNA sequence of GarV-C genomic RNA (GenBank: AB010302.1) was synthesized and inserted into the pBI101 binary vector under the control of the 35S promoter (pBI-GarV-C) (S15 Fig). The CRP ORF in pBI-GarV-C was exchanged with either the BCRP ORF or DCRP ORF using the integrated cloning site (StuI and SpeI restriction enzyme sites) creating the constructs pBI-GarV-C-BCRP and pBI-GarV-C-DCRP. Garlic shoots were agroinfiltrated with Agrobacterium cells containing an infectious clone as described above.

Template DNA of ryhB and luxS was prepared for in vitro transcription by PCR using primers containing the T7 promoter sequences as shown in Supplementary Table S2. RNA was synthesized by in vitro transcription using T7 RNA polymerase (Takara, Tokyo, Japan) using the prepared template DNA at 37 °C following the protocol provided and was further purified using a Monarch RNA Cleanup Kit (NEB, Cambridge, USA).

Digoxigenin (DIG)-labeled cRNA probes were designed on a murine or human transferrin ORF sequence (NM_133977, NM_001063.3); mouse forward; 5′-gggtaatacgactcactatagggtgcctgtgtgaagaaaacc-3′; mouse reverse, 5′-gggattaaccctcactaaagggaaactgcccgagaagaaact-3′; human forward, 5′-gggtaatacgactcactatagggctccacccttaaccaatacttc-3′; and human reverse, 5′-gtgattaaccctcactaaagggaatcccttctcaaccagacacc-3′. Forward and reverse primers were incorporated with T7 and T3 promoter sequences (underlined), respectively. The target mouse or human cDNAs (Origene, Rockville, MD, USA) were amplified by PCR. In vitro transcription was then performed using the DIG labeling system for RNA (Roche Diagnostics, Mannheim, Germany) and T3 RNA polymerase (Roche Diagnostics) for synthesizing antisense probes, or T7 RNA polymerase (Takara Bio Inc., Shiga, Japan) for synthesizing sense probes.