Total RNA was extracted from RIN-m5F cells by using TRI-zol (Invitrogen). Reverse transcription was performed using 1 μg of total RNA by the SuperScript III first strand system for RT-PCR (Invitrogen). The sequences of the primers used for PKG amplification were 5′-AAGATTCTCATGCTCAAGGA-3′ and 5′-CAGCTCCAAGTTCTTCATGA-3′, forward and reverse, respectively. β-actin, used as a control, was amplified using a sense primer 5′-AAGATGACCCAGATCATGTT-3′ and an antisense primer 5′-GAGTACTTGCGCTCAGGAGG-3′(Suppl Table S1 ). End-point PCR was carried out in 50 μl (total volume) containing 5 μl cDNA, 1× PCR buffer, 200 μM each deoxynucleotide triphosphate, 200 nM each primer, 1.5 mM MgCl2, and 2.5 units of Taq DNA polymerase on a thermal cycler for 30 cycles. Denaturation, annealing and elongation were carried out at 94 °C for 45 s, 55 °C for 30 s, and 72 °C for 60 s, respectively. PCRs were performed using Taq DNA polymerase (Invitrogen) with a 200 nM concentration of each primer.
Superscript 3 first strand system for rt pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SuperScript III First-Strand System for RT-PCR is a complete system for first-strand cDNA synthesis from RNA templates. It includes a thermostable reverse transcriptase enzyme, RNase inhibitor, and necessary buffers and reagents.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Abi prism 7900ht sd, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Quantifast multiplex rt pcr kit, by Qiagen (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Rnase free dnase set, by Qiagen (1 mentions)
Nanodrop nd 1000 system, by Thermo Fisher Scientific (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Chemidoc mp imaging system, by Bio-Rad (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Dnase 1, by Thermo Fisher Scientific (1 mentions)
7 protocols using superscript 3 first strand system for rt pcr
1
Reverse Transcription and PCR for PKG Expression
2
Expression Profiling of Avian Antimicrobial Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The unigenes annotated as Avian Beta Defensin 2 (CL60147Contig), Avian Beta Defensin 13 (CL64604Contig1) and Cathelicidin 2 (CL31589Contig1) were selected for expression analysis. The expression profiles of the selected genes in 14 tissues of 3 crows were analyzed by real-time PCR using Roche -Light Cycler® 480 System. About 1 µg of total RNA extracted from each tissue was reverse transcribed using Superscript™ III First-Strand System for RT-PCR (Invitrogen). Real-time PCR was performed in 10 µl reaction containing cDNA sample, SYBR green mix, gene-specific primers (Table 4 ), and double-distilled water. The expression level of the three genes were measured by the 2(−ΔΔCt) method using β-actin as internal reference gene and oesophagus as calibrator tissue56 (link),120 (link)–122 (link).
Primer sequences for real time PCR.
| Gene name | Forward primer | Reverse primer |
|---|---|---|
| Avian beta-defensin 2 (AvBD-2) | ACAGCCATGAAGATCCTTTACC | GGCAAAGACAAACCTGGAGA |
| Avian beta-defensin 13 (AvBD-13) | CAGCAGTGCAGAAGCAACC | ATTGCTGCAGCTCCCTTC |
| Cathelicidin 2 (CATH-2) | CCGTGGATTCCTACAACCAG | TCCATCATGCTGAAGTTGAGTC |
| β- actin | CCCCACCTGAGCGTAAATACT | CCTGCTTGCTGATCCACAT |
3
mRNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNeasy Mini Kit (Qiagen, Hilden, Germany) was used for messenger RNA (mRNA) extraction according to manufacturer’s instructions. Then, 1 μg of total mRNA was reverse-transcribed with Oligo(dT) using SuperScript III™ first-strand system for RT-PCR (Invitrogen, Carlsbad, CA, USA) or the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA) in a final volume of 20 μL following manufacturer’s instructions. Gene expression was analyzed using Taqman Universal Master Mix II with UNG (Roche Applied Biosystems) and fluorescence-labeled specific probes (Life Technologies, Carlsbad, CA, USA) for CLPX (#Hs01101010_m1), HSP9 (#Hs00269818_m1) and RPLP0 (#4326314E) on a 7900HT SDS (Applied Biosystems, CA, USA). Then, 2.5 ng of cDNA was used to measure mRNA levels. Relative quantification was carried out using the 2-deltadeltaCt method using the software ABI PRISM 7900HT SDS version 2.2 (Applied Biosystems).
4
Evaluating EBV Infection and Inflammasome Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the RNeasy mini kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Contaminating DNA was removed by on-column DNase digestion using the RNase-free DNase set (Qiagen).
To evaluate EBV infection status, the pattern of EBV infection was determined by quantifying the expression of six latent (EBNA1, EBNA2, LMP1, LMP2, EBER1, and BARTs) and two lytic (BZLF1 and glycoprotein 350/220) EBV genes by one-step RT-PCR, using QuantiFast Multiplex RT-PCR Kits (Qiagen) as described previously [13 (link),14 (link)]. The stably-expressed housekeeping gene, beta-2-microglobulin, was used as an endogenous control and reference gene for relative quantification.
Inflammasome-related mRNA expression was quantified by real-time PCR using SYBR Premix Ex Taq II (Takara, Kusatsu, Japan). 18S ribosomal RNA was used as an endogenous control and reference gene for relative quantification. cDNA was synthesized using the SuperScript III First-Strand System for RT-PCR (Invitrogen). The primers are listed inTable 2 .
To evaluate EBV infection status, the pattern of EBV infection was determined by quantifying the expression of six latent (EBNA1, EBNA2, LMP1, LMP2, EBER1, and BARTs) and two lytic (BZLF1 and glycoprotein 350/220) EBV genes by one-step RT-PCR, using QuantiFast Multiplex RT-PCR Kits (Qiagen) as described previously [13 (link),14 (link)]. The stably-expressed housekeeping gene, beta-2-microglobulin, was used as an endogenous control and reference gene for relative quantification.
Inflammasome-related mRNA expression was quantified by real-time PCR using SYBR Premix Ex Taq II (Takara, Kusatsu, Japan). 18S ribosomal RNA was used as an endogenous control and reference gene for relative quantification. cDNA was synthesized using the SuperScript III First-Strand System for RT-PCR (Invitrogen). The primers are listed in
5
cDNA Synthesis from RNA Using SuperScript III
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A reverse transcription kit (SuperScript III First-Strand System for RT-PCR; Invitrogen cat#18080-051) was used for cDNA synthesis. cDNA was synthesized from 1 μg of RNA with SuperScript III (Life Technologies, VIC, AUS), using random hexamers. cDNA yield and quality were determined using a NanoDrop spectrophotometer (NanoDrop ND-1000 system, Thermo Fischer Scientific). A 260/280 ratio of ~ 1.8 and a 260/230 ratio 2 > 2.2 was accepted for DNA as per Thermo Scientific Technical Bulletin T042.
6
Reverse Transcription-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals were collected from plates with M9 buffer (22 mM KH2PO4, 42 mM Na2HPO4, 83 mM NaCl, 0.1 mM MgSO4), and lysed by thermal shock. Total RNA was extracted using Trizol Reagent (Invitrogen) and treated with RQ1 RNAse‐Free DNAse (Promega). RNA concentration was measured at 260 nm. Total cDNA was prepared from 700 ng DNase‐treated RNA using SuperScript III First‐Strand System for RT‐PCR (Invitrogen). Random hexamers were used as primers for the overall cDNA synthesis. PCR was performed using Taq DNA Polymerase with MgCl2 Buffer (Sigma) according to the manufacturer's instructions using gene‐specific primers. RT‐PCR products were separated through electrophoresis on ethidium bromide‐containing 1.2% agarose gel. Gene expression level was analysed through a semi‐quantitative reverse transcription‐PCR technique, using ama‐1 for expression level normalization of the target genes. Images and quantification were obtained with a ChemiDoc™ MP Imaging System (BIO‐RAD). Primers were designed on the basis of sequences retrieved from C. elegans database (Wormbase, http://www.wormbase.org ) and are reported in Table S1 .
7
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 2 g fresh tissue following the protocol described by TRIzol TM Reagent manual (Invitrogen TM , Carlsbad, CA, USA). Samples were treated with DNAseI (Invitrogen TM ). The quantity of the RNA was assessed spectroscopically and the quality through agarose gel electrophoresis. Each sample was reverse-transcribed into cDNA using the commercial kit SuperScript ® III First-Strand System for RT-PCR (Invitrogen TM ) from 2 μg RNA.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!