Trizol rna isolation protocol

Manufactured by Thermo Fisher Scientific

Sourced in United States

TRIzol is a reagent for the isolation and purification of total RNA from biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components. The TRIzol RNA isolation protocol allows for the extraction of high-quality, intact RNA from a variety of sample types, including cells, tissues, and biofluids.

Automatically generated - may contain errors

Lab products found in correlation

29 protocols using trizol rna isolation protocol

Quantifying Iron Regulation of ireA

Check if the same lab product or an alternative is used in the 5 most similar protocols

M9 minimal medium was used to assess the expression of ireA.M9 medium or M9 medium with Fe (0.1 mM Fe(NO₃)₃) were used as low and high Fe content media, respectively. DE205B was cultured in both M9 media to the mid-log phase and the expression of ireA was detected by quantitative real-time reverse transcription PCR(qRT-PCR). The real –time PCR primers were designed by PrimerQuest Tool IDT (http://sg.idtdna.com/primerquest/Home/Index). Briefly, total RNA was extracted from 1 ml of bacteria culture using the Trizol RNA isolation protocol (Invitrogen, Shanghai, China) and cDNA was amplified by reverse transcription according to the instructions of the primeScript RT reagent Kit (Takara). Quantitative real-time PCR (qPCR) was carried out using the ABI Prism 7300 and Sequence Detection System software version 1.4 (Applied Biosystems, Foster City, CA, USA), according to the instructions of the SYBR Premix Ex Taq (Takara, Dalian, China). QPCR primers for ireA (QireA-F and QireA-R) are listed in Table 4. DnaE was used as a reference gene. Assays were performed three times. The relative expressions of ireA in different media were calculated using the 2^-△△Ct method [28 (link)]. Statistical analysis was performed using an unpaired t test in Graphpad Prism 5.0.

Li Y., Dai J., Zhuge X., Wang H., Hu L., Ren J., Chen L., Li D, & Tang F. (2016). Iron-regulated gene ireA in avian pathogenic Escherichia coli participates in adhesion and stress-resistance. BMC Veterinary Research, 12, 167.

+ Open protocol

+ Expand

Crypt Cells RNA Extraction and qRT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Intestines were gently scraped to remove villi, and treated with EDTA to isolate crypt cells. RNA was extracted using the Trizol RNA isolation protocol (Invitrogen, Carlsbad, CA), followed by RNA cleanup using the RNeasy Mini Kit (Qiagen, Hilden, Germany). mRNA expression was determined using quantitative RT-PCR, as described previously (Gupta et al., 2007 (link)). The SYBR green qPCR master mix (Agilent, Santa Clara, CA) was used in all qPCR reactions, and the fold change was calculated relative to the geometric mean of Tbp and β-Actin, using the △CT method. The method of normalizing to the geometric mean of a set of reference genes has been described previously (Vandesompele et al., 2002 (link)). Primer sets can be found in Table 1.

10.7554/eLife.12975.022

Table 1.

qRT-PCR primer sequences.

DOI:http://dx.doi.org/10.7554/eLife.12975.022

Gene	Forward 5'-3'	Reverse 5'-3'
Beta-actin	GAAGTGTGACGTTGACATCCG	GTCAGCAATGCCTGGGTACAT
TBP	CCCCTTGTACCCTTCACCAAT	GAAGCTGCGGTACAATTCCAG
Dnmt1	CTTCACCTAGTTCCGTGGCTA	CCCTCTTCCGACTCTTCCTT
Dnmt3a	GCACCAGGGAAAGATCATGT	CAATGGAGAGGTCATTGCAG
Dnmt3b	GGATGTTCGAGAATGTTGTGG	GTGAGCAGCAGACACCTTGA

Elliott E.N., Sheaffer K.L, & Kaestner K.H. (2016). The ‘de novo’ DNA methyltransferase Dnmt3b compensates the Dnmt1-deficient intestinal epithelium. eLife, 5, e12975.

+ Open protocol

+ Expand

Quantifying Steroidogenic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from cell pellets using TRIzol following Invitrogen′s TRIzol RNA isolation protocol. Invitrogen M-MLV and random hexamers were used to convert the RNA to cDNA. The following primers were used: SRD5A1 (forward) 5′-ACGGGCATCGGTGCTTAAT-3′, (reverse) 5′-CCAACAGTGGCATAGGCTTTC-3′; STAR (forward) 5′-GCCCATGGAGAGGCTCTATG-3′, (reverse) 5′-TTCCACTCCCCCATTGCTT-3′; HSD3B2 (forward) 5′-CGGGCCCAACTCCTACAAG-3′, (reverse) 5′-TTTTCCAGAGGCTCTTCTTCGT-3′; RDH5 (forward) 5′-GCCCGCCAGCAATGC-3′, (reverse) 5′-CGCCCAAAGCCTGAGTCA-3′; HSD17B3 (forward) 5′-TGGGACAGTGGGCAGTGA-3′, (reverse) 5′-CGAGTACGCTTTCCCAATTCC-3′; HSD17B6 (forward) 5′-ACTGCTGCCTGGTCTGCAAAGA-3′, (reverse) 5′-GAGCCACATAGTGAGGGTGCTTCC-3′; AKR1C1 (forward) 5′-GGAGGCCGTGGAGAAGTGTA-3′, (reverse) 5′-GTTGGACACCCCGATGGA-3′; AKR1C3 (forward) 5′-GGAGAAGTGTAAAGGATGCAGGATT-3′, (reverse) 5′-GTACTTGAGTCCTGGCTTGTTGAG-3. Roche SYBR green master mix was used with cDNA and primers for PCR on an ABI Viia7 real time PCR machine. Data were normalized to the level of GAPDH per sample. Primers were purchased from Integrated DNA Technologies.

Deb S., Pham S., Ming D.S., Chin M.Y., Adomat H., Hurtado-Coll A., Gleave M.E, & Guns E.S. (2018). Characterization of Precursor-Dependent Steroidogenesis in Human Prostate Cancer Models. Cancers, 10(10), 343.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Rat Nucleus Pulposus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from rat nucleus pulposus cells or tissues by using the TRIzol RNA isolation protocol (Invitrogen). The cDNA was synthesized by using a FastKing RT kit (with gDNase) (Qiagen). RT-PCR and qRT-PCR were performed by using a SuperReal PreMix Plus kit (SYBR Green) (Qiagen). All primers were synthesized by Takara Bio, Inc. (Tokyo, Japan). IL-1β: F-CACCT CTCAA GCAGA GCACA G, R-GGGTT CCATG GTGAA GTCAA C; NOS2: F-GACCA GAAAC TGTCT CACCT G, R-CGAAC ATCGA ACGTC TCACA; IL-18: F-ATATC GACCG AACAG CCAAC, R-TTCCA TCCTT CACAG ATAGG G; GAPDH: F-GGCAC AGTCA AGGCT GAGAA TG, R-ATGGT GGTGA AGACG CCAGT A.

Bi F., Liu W., Wu Z., Ji C, & Chang C. (2020). Antiaging Factor Klotho Retards the Progress of Intervertebral Disc Degeneration through the Toll-Like Receptor 4-NF-κB Pathway. International Journal of Cell Biology, 2020, 8319516.

+ Open protocol

+ Expand

Ascl1-Driven Neuronal Fate Mapping

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ascl1 infected Tau-EGFP reporter MEFs were FAC-sorted 5, 7, 10, 12 or 22 days post-Ascl1 induction with dox. RNA was then extracted from both Tau-EGFP positive and negative populations from each time point, as well as uninfected control MEFs and unsorted d2 Ascll infected MEFs using the TRIzol RNA isolation protocol (Invitrogen, 15596-018). Reverse transcription into cDNA was performed using the SuperScript III First-strand Synthesis System (Invitrogen, 18080-051) and qRT-PCR was performed using Sybr Green (Thermo Fisher Scientific, 4309155). Immunostaining was performed as previously described^{8 (link)}. Antibodies and qRT-PCR primers are listed in the Supplementary Information.

Treutlein B., Lee Q.Y., Camp J.G., Mall M., Koh W., Shariati S.A., Sim S., Neff N.F., Skotheim J.M., Wernig M, & Quake S.R. (2016). Dissecting direct reprogramming from fibroblast to neuron using single-cell RNA-seq. Nature, 534(7607), 391-395.

+ Open protocol

+ Expand

DNAJC19 Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To investigate the effect of the identified variant on DNAJC19 gene expression, RNA was extracted from peripheral blood mononuclear cell samples (PBMCs) of the patient and her family (mother, father, and sister), as well as the control, using a standard TRIzol RNA isolation protocol (Invitrogen, Carlsbad, CA, USA). RNA quantification and purity were tested using standard methods. The obtained RNA was then reverse‐transcribed using a high‐capacity cDNA reverse transcription kit (Applied Biosystems/Thermo Fisher Scientific). The qPCR reaction was conducted using a SYBR Green Master Mix (Applied Biosystems/Thermo Fisher Scientific) on a QuantStudio 6 Flex Real‐Time PCR System (Applied Biosystems/Thermo Fisher Scientific). The primer sequences for the DNAJC19 cDNA can be provided upon request. All tested samples were normalized to the GAPDH gene as an endogenous control, and all reactions were repeated independently and performed in three replicate experiments (Asiri et al., 2020 (link)).

Al Tuwaijri A., Alyafee Y., Alharbi M., Ballow M., Aldrees M., Alam Q., Sleiman R.A., Umair M, & Alfadhel M. (2022). Novel homozygous pathogenic mitochondrial DNAJC19 variant in a patient with dilated cardiomyopathy and global developmental delay. Molecular Genetics & Genomic Medicine, 10(8), e1969.

+ Open protocol

+ Expand

Ascl1-Driven Neuronal Fate Mapping

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

Breast Cancer Cell Response to Dietary Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human breast cancer MDA-MB-231 and MDA-MB-453 cells were treated with either GTPs or SFN or the combinations of both at the indicated concentrations for 12, 24, 48 and 72 h. Total RNA was extracted at approximately 70–80% confluence using the Trizol–RNA isolation protocol according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Two micrograms of RNA was reverse-transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Real-time quantitative PCR was carried out in a lightcycler-480 thermocycler (Roche, Germany) using SsoFast EvaGreen Supermix detection system (Bio-Rad). The primers specific for p21^CIP1/WAF1, KLOTHO and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) were obtained from Sigma-Aldrich. The sequences of primers with their respective annealing temperatures (T_A) are given in Supplementary Table S1. The reaction conditions were 30 s at 94 °C followed by 45 cycles (5 s at 94 °C; 20 s at T_A °C; 30 s at 72 °C) and extension at 72 °C for 2 min. The relative levels of mRNA expression were calculated using the cycle threshold (C_t) method: 2^−ΔΔCt = 2^{{ΔCt (treated samples)−ΔCt (untreated control)}}, where ΔC_t = C_t (Gene of interest) − C_t (GAPDH).

Sinha S., Shukla S., Khan S., Tollefsbol T.O, & Meeran S.M. (2015). Epigenetic reactivation of p21CIP1/WAF1 and KLOTHO by a combination of bioactive dietary supplements is partially ERα-dependent in ERα-negative human breast cancer cells. Molecular and cellular endocrinology, 406, 102-114.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

In this study, we use TRIzol reagent (Invitrogen, Carlsbad, CA, United States) to extract total RNA from human nucleus pulposus cells and rat nucleus pulposus tissues.
Total RNA was extracted from human nucleus pulposus cells or rat nucleus pulposus tissues by using the TRIzol RNA isolation protocol (Invitrogen, Inc., Carlsbad, CA, United States). AG Reverse Transcription Kit (Accurate biotechnology, Changsha, Hunan, China) was used to reverse transcribe total RNA into cDNA and SYBR Premix ExTaq II (Yeasen Biotechnology, Shanghai, China) SYBR was used for the reactions of qPCR. Then we used a ABI 7500 sequencing detection system (Applied Biosystems, Foster City, CA, United States) to measure the reactions and applied the β-actin as a control RNA expression level. Data were analyzed by GraphPad Prism (GraphPad Prism Software 6.0, United States). The primers we used in the experiments: β-actin, AGAGCTACGAGCTGCCTGAC, PLK1, CACCAGCACGTCGTAGGATT, MMP3, CCTACAAGGAGGCAGGCAAG, MMP13, TCGGCCACTCCTTAGGTCTT, COL2A1, CCAGATGACCTTCCTACGCC, ADAMTS4, AACGTCAAGGCTCCTCTTGG, ADAMTS5, CCGGAGCCACTGCTTCTATC, aggrecan, GGGACCTGCAAGGAGACAGAG, SOX9, GCTCTGGAGACTTCTGAACGA, p53, CCAGGATGTTGCAGAGTTGTTA, p21, TATTTTGTCCTTGGGCTGCCT, p16, CTTCGGCTGACTGGCTGG.

Zhang Z., Huang Y., Xu N., Wang J., Yao T., Xu Y., Qiao D., Gao J., Shen S, & Ma J. (2022). PLK1 Mitigates Intervertebral Disc Degeneration by Delaying Senescence of Nucleus Pulposus Cells. Frontiers in Cell and Developmental Biology, 10, 819262.

+ Open protocol

+ Expand

Chondrocyte Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

NP cells were cultured in 10-cm plates (5 × 10⁵ cells/plate) with or without ROCKi for 72 h, and total RNA was extracted using the TRIzol RNA isolation protocol (Invitrogen, USA) at P1, P4, and P7. RNA was treated with RNase-free DNase I. Total RNA (100 ng) was used as a template for cDNA synthesis by the reverse transcription. Expression levels were determined by SYBR Green PCR Master Mix (Applied Biosystems, UK) to which gene-specific forward and reverse PCR primers (TaKaRa Bio Inc., Japan) for the genes SOX9, COL2A1, Aggrecan, and COL1A1 were added (Table 1). PCR reactions were performed by 7500 Fast system (Applied Biosystems, USA) according to the manufacturer's instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping control gene, and the arbitrary intensity threshold (Ct) of amplification was computed and further calculated as 2^-ΔΔCT relative to levels of non-treated P1 cells.

Nukaga T., Sakai D., Schol J., Suyama K., Nakai T., Hiyama A, & Watanabe M. (2019). Minimal Sustainability of Dedifferentiation by ROCK Inhibitor on Rat Nucleus Pulposus Cells In Vitro. Spine Surgery and Related Research, 3(4), 385-391.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!