Clc genomics software

The BLAST analysis (blastp algorithm, word size 3, e-value 1) was performed to determine polymorphisms in 55 r-proteins, including 34 large and 21 small subunit ones, with the CLC Genomics software (CLC Bio) (Supplementary Table S6). Subsequently, the r-proteins alleles were recorded and combined for all strains in binary form as 1 (present) and 0 (absent). The phyloproteomic tree was built using Dice coefficient and UPGMA clustering with NTSYSpc software ver. 2.1 (Exeter Software). The clusters of bacilli with similar patterns of r-proteins were denoted as ribosomal clusters (r-clusters). Concurrently, we compared amino acids sequences of the r-proteins using MEGA7 software58 (link). Compatibility of the strains’ affiliation to particular r-clusters with their genetic relatedness, i.e. according to the digital DND-DNA hybridization (dDDH) method, was confirmed by comparison of pycA gene42 (link) (Supplementary Fig. S13).
The entire procedure was reproduced for six cold shock proteins (CSPs), CspA, CspB, CspE, CspC, CspD1 and CspD2 (Supplementary Table S3).

Total RNA was extracted from RF7–4 ripe fruits using the RNeasy Plant Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instruction. The FvUGT1 full-length open reading frame was amplified by the Pfx DNA Polymerase (Invitrogen, Frederick, MD, USA) using the gene-specific primer pair (ATGGCACCAGTATCAAACCAG/ATTGGTTGTGGTCATTTCCAAC) based on the strawberry genome data in GDR (https://www.rosaceae.org/). The FvUGT1 amino acid sequence was aligned with other plant UGTs using CLC Genomics software (CLC, Aarhus, Denmark). The calmodulin-binding site was predicted utilizing the Calmodulin Target Database (http://calcium.uhnres.utoronto.ca). The homology model of FvUGT1 was constructed based on the crystal structure of grape VvGT1 (pdb code: 2C1Z) in Swiss-model (http://swissmodel.expasy.org) [13 (link)]. The model and template were compared using the Swiss PDB viewer (http://spdbv.vital-it.ch/) [57 (link)].

FRI gene, accession Bra035723 (Sun et al., 2013 (link)), was obtained from the Brassica database¹. It was aligned with other Brassica sequences deposited in the NCBI GenBank with CLC Genomics software (Qiagen) to design ‘FRI-Seq’ sequencing primers (Table 1). ‘PDS-Seq-Dig’ sequencing primers (Table 1) were designed by aligning B. napus PDS gene (HM989807) with other GenBank sequences. PCR products were cloned in a pGEM-T-Easy Vector System (Promega), and the plasmid DNA was Sanger-sequenced.
The sequences of FRI and PDS genes obtained from three Brassica species (B. oleracea, B. napus, and B. rapa) were aligned with CLC Genomics software, and potential target sites in conserved regions of FRI and PDS genes were designed with CLC Genomics Workbench and CRISPR RGEN Tools Cas-Designer (Park et al., 2015 (link)).
Double-stranded template DNA for in vitro transcription was obtained by annealing two overlapping oligonucleotides as described by Gagnon et al. (2014) (link). sgRNAs (Table 2) were transcribed in vitro with a HiScribe^TM T7 Quick High Yield RNA Synthesis Kit (NEB), purified with a MEGAclear^TM Kit (Ambion) according to the manufacturer’s instructions and quantified using a NanoVue Plus spectrophotometer (GE Healthcare).