Emem growth media

Human ACE2 coding sequence was cloned into a lentiviral vector as described (23 (link)). sgRNAs targeting human ORAI1 (gRNA target sequence GATCGGCCAGAGTTACTCC) and human STIM1 (TGAGGATAAGCTCATCAGCG) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1; gRNA target sequence GGCGTGTTTCCAGACTGTTT). Vero E6, HEK293 and A549 cells were obtained from the American Type Culture Collection center (ATCC, Manassas, VA). Vero cells were cultured in EMEM growth media (ATCC) supplemented with 10% (v/v) fetal bovine serum (FBS, Hyclone) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO₂. HEK293 cells were cultured in DMEM (Mediatech) supplemented with 10% (v/v) FBS (Hyclone), 2 mM L-glutamine (Mediatech), 10 mM HEPES (Mediatech) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO₂. A549 cells were cultured in Ham’s F12-K (Kaighn’s) medium (ThermoFisher) supplemented with 10% (v/v) FBS (Hyclone), 10 mM HEPES (Mediatech) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO₂.