Protocols for total RNA extraction, cDNA synthesis and quantitative real-time polymerase chain reaction (PCR) were described previously (Tang et al., 2014 (link)). Mice were sacrificed immediately after the 24-h hypoxia episode. Bilateral hippocampus (n = 4 in each group) were dissected and extracted for total RNA with RNAiso Plus (Total RNA extraction reagent; Takara, Shiga, Japan). According to Revertra Ace qPCR RT kit (Takara, Shiga, Japan) instructions, total RNA was synthesized to cDNA. Real-time PCR was performed with TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) and monitored by the Real-time PCR System (Applied Biosystems 7500 Real-time PCR Systems). The primer sequences were provided upon request as summarized in Table 1 . The relative expression levels of each primer sequences mRNA were analyzed by the 2−ΔΔCt algorithm normalizing to GAPDH and relative to the control groups.
Revertra ace qpcr rt kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
The ReverTra Ace qPCR RT Kit is a reverse transcription kit designed for quantitative real-time PCR (qPCR) applications. The kit includes reverse transcriptase enzyme, buffer, and other necessary components for the conversion of RNA to cDNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Rnaiso plus, by Takara Bio (5 mentions)
Transstart top green qpcr supermix, by Transgene (5 mentions)
Trizol reagent, by Takara Bio (5 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Sybr green real time pcr master mix, by Takara Bio (3 mentions)
Abi 7900 thermocycler, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
All in onetm mirna first stand cdna synthesis kit, by GeneCopoeia (3 mentions)
Real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Tb green real time pcr master mix, by Takara Bio (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Takara minibest universal rna extraction kit, by Takara Bio (2 mentions)
Thunderbird probe qpcr mix kit, by Takara Bio (2 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Real time pcr system, by Bio-Rad (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
Abi 7500 steponeplus system, by Thermo Fisher Scientific (1 mentions)
31 protocols using revertra ace qpcr rt kit
1
Quantitative Real-time PCR Analysis of Hippocampal Gene Expression
2
qRT-PCR for lncRNA, miRNA, and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the PC tissues or cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Subsequently, total RNA was reverse transcribed into cDNA using the ReverTra Ace qPCR RT kit (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocol. The SYBR Green real-time PCR Master Mix (Takara Biotechnology Co., Ltd.) was used for qPCR on an ABI 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: Pre-denaturation at 95°C for 1 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec. GAPDH (for lncRNA and mRNA) or U6 (for miRNA) served as the internal references. Finally, the 2−ΔΔCq method (25 (link)) was used to calculate and analyze relative target gene expression. The primer sequences were designed as follows: TTN-AS1 forward, 5′-CGATACCATTGAACACGCTGC-3′ and reverse, 5′-GGTTGAGGGTCCCAGTG-3′; miR-589-5p forward, 5′-CGCCTTGAATCGGTG-3′ and reverse, 5′-GTGCAGGGTCCGAGGT-3′; FOXP1 forward, 5′-AGGACTTGCACAAGCAGAAC-3′ and reverse, 5′-GTTGGCGTACACGGGCGGCT-3′; GAPDH forward, 5′-AGCCACATCGCTCAGACAC-3′ and reverse, 5′-GCCCAATACGACCAAATCC-3′; and U6 forward, 5′-GCTTCGGCAGCACATATACTAAAAT-3′ and reverse, 5′-CGCTTCACGAATTTGCGTGTCAT-3′.
3
RNA Extraction and Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, USA) was used to extract total RNA from PC tissues or cells following the manufacturer’s protocol. The ReverTra Ace qPCR RT Kit (Takara, China) was applied to reverse-transcribe total RNA into cDNA. The SYBR Green Realtime PCR Master Mix (Takara) was used for qPCR with cDNA as templates and GAPDH or U6 as internal controls. The relative expression of genes was calculated and analyzed through the 2−ΔΔCt method. All PCR sequences involved in this study are detailed in Supplementary Table 1 .
4
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol Reagent (TAKARA) by the manufacturer’s instruction. The reverse transcription was conducted with the ReverTra Ace qPCR RT kit (TAKARA), with relative cDNA expressions determined by qRT-PCR with TB Green Realtime PCR Master Mix (TAKARA). Amplification was performed at 95°C for 5 min, followed by 40 cycles of that at 95°C for 15 s, at 60°C for 20 s, and at 72°C for 20 s. Fluorescent signals were studied through a Light Cycler/Light Cycler 480 System (Roche), with relative mRNA levels calculated by 2-ΔΔCT method (with CT as threshold cycle). Primers employed in this study are listed in Table 1
5
Total RNA Extraction and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protocols for total RNA extraction, cDNA synthesis and quantitative real-time polymerase chain reaction (PCR) were described previously [11 (link)]. Cortex was dissected and extracted for total RNA with RNAiso Plus (Total RNA extraction reagent; Takara, Shiga, Japan). According to Revertra Ace qPCR RT kit (Takara, Shiga, Japan) instructions, total RNA was synthesized to cDNA. Real-time PCR was performed with TransStart Top Green qPCR SuperMix (TransGen Biotech, Beijing, China) and monitored by the Real-time PCR System (Bio-Rad CFX96 Real-time PCR Systems). The primer sequences were provided upon request as summarized in Supplementary Table 2 . The relative expression levels of each primer sequences mRNA were analyzed by the 2−ΔΔCt algorithm normalizing to GAPDH and relative to the control groups.
6
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Takara), and cDNA was synthesized using a ReverTra Ace qPCR RT Kit. Relative gene expression levels were determined using SYBR Premix Ex TaqTM Kit and the primers shown in Supplementary Table S2 . The comparative threshold cycle method was used to calculate gene expression levels, and the results were normalized to GAPDH, which was used as the gene reference.
7
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of samples was isolated by RNAiso Plus reagent (Takara) according to the manufacturer's protocol. ReverTra Ace qPCR RT Kit (TaKaRa) was used to obtain cDNA. Quantitative reverse transcription polymerase chain reaction (qRT‐PCR) was performed using ABI 7500 StepOnePlus system (Applied Biosystems). β‐actin were used as internal controls and each reaction was performed in triplicate. All primers are shown in Supplemental file 1.
8
Quercetin and Flavonoid Effects on SKOV3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SKOV3 cells were maintained in DMEM (Gibco, USA) with 10% FBS (Gibco, USA), 100 U/mL penicillin, and 100 g/mL streptomycin (Sigma, USA). The cells were cultured at 37°C in a water-saturated atmosphere under 5% CO2.
Quercetin (Sigma, USA, purity ≥ 99.0%) and luteolin and wogonin (Shanghai Yuanye, China, purity ≥ 98.0%) were dissolved in dimethyl sulfoxide (DMSO)The final amount of DMSO added to the cell culture medium was <0.1% to ensure that there were no effects on cells.
MTT Kit (CCK) − 8 (Beyotime, China), paraformaldehyde (Beyotime, China), crystal violet (Sigma, USA), TRIzol solution (Life, China), ReverTra Ace Qpcr RT Kit (Takara, Japan), SYBR-Green Real-Time PCR Master Mix kit (Takara, Japan), Primers (Sangon Biotech, China), BCA protein Quantifier kit (Invitrogen, USA), and anti-PI3K, anti-AKT, anti-p-AKT, anti-Caspase (CST, USA) were used in this study.
Quercetin (Sigma, USA, purity ≥ 99.0%) and luteolin and wogonin (Shanghai Yuanye, China, purity ≥ 98.0%) were dissolved in dimethyl sulfoxide (DMSO)The final amount of DMSO added to the cell culture medium was <0.1% to ensure that there were no effects on cells.
MTT Kit (CCK) − 8 (Beyotime, China), paraformaldehyde (Beyotime, China), crystal violet (Sigma, USA), TRIzol solution (Life, China), ReverTra Ace Qpcr RT Kit (Takara, Japan), SYBR-Green Real-Time PCR Master Mix kit (Takara, Japan), Primers (Sangon Biotech, China), BCA protein Quantifier kit (Invitrogen, USA), and anti-PI3K, anti-AKT, anti-p-AKT, anti-Caspase (CST, USA) were used in this study.
9
Osteogenic and Angiogenic Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare the mRNA expressions of osteogenic and angiogenic genes of rBMSCs in the medium with HG and normal glucose and to further evaluate the effects of different scaffolds on osteogenic differentiation capacity of rBMSCs, the mRNA expressions of collagen type I alpha 1 (Col1a1) on day 7 after osteoinduction were determined, whereas BMP-2, VEGFA, runt-related transcription factor 2 (Runx2), osteocalcin (OCN), and osteopontin (OPN) on day 14 after osteoinduction were determined (Figure 2B ). The total RNA was extracted from the cells with TRIzol Reagent (Thermo Fisher Scientific, United States) and reverse transcribed to cDNA using the ReverTra Ace qPCR RT Kit (TaKaRa, Japan). Then, the quantitative real-time PCR (qPCR) was carried out using TB Green Premix Ex Taq II (TaKaRa, Japan) as described by the manufacturer. The primers were shown in Table 1 , and the relative gene expression was calculated using the 2−ΔΔCt method.
10
Quantifying circRNA and miRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagents (Invitrogen, Carlsbad, CA, USA) according to the standard RNA extraction protocol. Reverse transcription was performed with the ReverTra Ace qPCR RT kit (TaKaRa, Dalian, China) to obtain cDNA. The Thunderbird SYBR qPCR mixture (TaKaRa), recommended by the manufacturer, was utilized for RT-qPCR analysis on the ABI Prism 7500 sequence detection system (Thermo Fisher Scientific). The primer sequences are provided below: Circ-0075305 (5′ATTACGGGCTCAACATGCCA 3′, 5′GCATCACATGGGCAGTAGGA 3′). miR-708-5p (5′caCAGCUAGGGUCUUCCUAGCAGCUCCUc 3′, 5′ggGUCGAUCU---AA-CAU--UCGAGGAa 3′). GAPDH (5′GAAGGTGAAGGTCGGAGT 3′, 5′GAAGATGGTGATGGGATTTC 3′). Primer was provided by Biosune (Shanghai, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!