Total RNA extraction kit (R1200), bought from Solarbio (China), was applied to isolate total RNA from cells. Then, a one-stepSuperRT-PCR mix kit (T2240, Solarbio, China) was applied to conduct the qRT-PCR reaction. Afterward, the signals were examined in a PCR system (EDC-810, Eastwin Life Sciences, Inc.). GAPDH was employed as the normalization control. The relative levels of gene were counted utilizing 2−ΔΔCT. The primers are displayed in Table 1 .
One step superrt pcr mix kit
Manufactured by Solarbio
Sourced in China
The One Step SuperRT-PCR Mix Kit is a ready-to-use reagent for reverse transcription and real-time PCR amplification in a single reaction. The kit combines all the necessary components for cDNA synthesis and real-time PCR analysis in a single tube, simplifying the workflow and reducing the risk of contamination.
Automatically generated - may contain errors
Lab products found in correlation
Mastercycler nexus, by Eppendorf (2 mentions)
Total rna extraction kit, by Solarbio (2 mentions)
Total rna extraction kit r1200, by Solarbio (1 mentions)
Sybr green pcr mastermix, by Solarbio (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Thermal cycler dice real time system 3, by Takara Bio (1 mentions)
Mirna first strand cdna synthesis kit, by Tiangen Biotech (1 mentions)
Protein isolation kit, by Thermo Fisher Scientific (1 mentions)
Triquick reagent, by Solarbio (1 mentions)
Mirna qrt pcr kit, by Tiangen Biotech (1 mentions)
Fastfire qpcr premix, by Tiangen Biotech (1 mentions)
6 protocols using one step superrt pcr mix kit
1
Total RNA Extraction and qRT-PCR Analysis
2
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAs were collected from cells and tissues. RT-qPCR was performed using One Step SuperRT-PCR Mix Kit (T2240, Solarbio) on a Mastercycler® nexus (6330000072, Eppendorf Inc.). All primers used in the present study were designed and synthesized by Genewiz Inc. GAPDH and U6 served as loading controls. The thermocycling conditions were as follows: denaturation at 94°C for 60 s, annealing at 37°C for 60 s for 30 cycles, and extension at 72°C for 120 s. The results were analyzed using the 2−ΔΔCt method [23 (link)]. The sequences of the primers were as follows: AC012668 forward (F) 5'-ATCAGAATCACCTGGCGGTC-3', reverse (R) 5'-TGTACTAGCGGCATCAGCAG-3'; SCD1 F 5''GCTGATCCTCATAATTCCCGA‐3', R 5';TTAAGCACCACAGCATATCGC‐3'; SREBP1 F 5'-ACAGTGACTTCCCTGGCCTAT-3', R 5'-GCATGGACGGGTACATCTTCAA-3'; FAS F 5'-AAATGAAAGCCAACTGCATCGAC-3', R 5'-ATTGGACCCTCGCTGAGCAC-3'; miR-380-5p F 5'-CTCGCTTCGGCAGCACA-3', R 5'-CAGTGCGTGTCGTGGAGT-3'; LRP2 F 5'-CCTTGCCAAACCCTCTGAAAAT-3'; R 5'-CACAAGGTTTGCGGTGTCTTTA-3'; and GAPDH F 5'-GGGAGCCAAAAGGGTCATCA-3', R 5'-TGATGGCATGGACTGTGGTC-3'.
3
Quantitative Expression Analysis of Stemness Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA Extraction Kit (Cat # R1200, Solarbio, Beijing, China) was used to extract RNA from cells. One Step SuperRT-PCR Mix Kit (Cat # T2240, Solarbio) was utilized to synthesize the complementary DNA (cDNA). qRT-PCR analysis was constructed using 2× SYBR Green PCR Mastermix (Cat # SR1110, Solarbio), and GAPDH mRNA was designated as the internal reference. 2−ΔΔct method was carried out to calculate the relative expression levels. The detailed primer sequences were listed as below: OTUB1 (forward: 5ʹ- ATGACCAGAGCACCTCCGACTACC-3ʹ, reverse, 5ʹ-GACCATTTACAACCACAGAAAAAC-3ʹ), SLC7A11 (forward: 5ʹ- GGTTTGTAATGATAGGGCGGCAGC-3ʹ, reverse, 5ʹ- CCATAGTAGGGACACACGGGGGAA-3ʹ), Oct4 (forward: 5ʹ- AGCGATCAAGCAGCGACTA-3ʹ, reverse, 5ʹ- GGAAAGGGACCGAGGAGTA-3ʹ), Sox2 (forward: 5ʹ- CATCACCCACAGCAAATGAC-3ʹ, reverse, 5ʹ-CAAAGCTCCTACCGTACCACT-3ʹ), CD133 (forward: 5ʹ- TGGTGGGGTATTTCTTTTGTATGT-3ʹ, reverse, 5ʹ- ACGCCTTGTCCTTGGTAGTGTTGT-3ʹ), GAPDH (forward: 5ʹ- CTTAGTTGCGTTACACCCTTTCTTG- 3ʹ, reverse, 5ʹ- CTGTCACCTTCACCGTTCCAGTTT-3ʹ).
4
Quantification of Target Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from macrophages, SVCs, BMDMs, or human WATs using the Total RNA Extraction Kit (Solarbio, Beijing, China) and reverse transcribed into cDNA using the One Step SuperRT-PCR Mix Kit (Solarbio). The SYBR Green Real-Time PCR Master Mix (TOYOBO, Japan) was used for quantitative RT-PCR to detect target gene expression levels. The relative gene expression normalized to β-actin was calculated using the 2−ΔΔCT method. Online supplementary Table 2 lists the primer sequences used in this study.
5
Quantitative RT-PCR Analysis of CLEC14A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA of the liver tissues, PBMCs, and cells was extracted by TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Reverse transcription and qPCR were carried out using One Step SuperRT-PCR Mix Kit (T2240; Solarbio) on Mastercycler® nexus (6330000072; Eppendorf, Inc.). All primers used in the present study were designed and synthesized by Genewiz Inc. GAPDH was used as the internal reference gene. The thermocycling conditions were as follows: denaturation at 94°C for 60s, then annealing at 37°C for 60s for 30 cycles. At last, the extension was at 72°C for 120s. The 2ΔΔCt method was used for calculating the fold change in gene expression level. The sequences of the primers were: CLEC14A forward primer, 5’-CTGCACCACGCTACCATGAA-3’; CLEC14A reverse primer, 5’-CCAGGAGAAACCCCGCAAA-3’; GAPDH forward primer, 5’-TGTGGGCATCAATGGATTTGG-3’; GAPDH reverse primer, 5’- ACACCATGTATTCCGGGTCAAT-3’.
6
Exosomal RNA and Protein Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total exosomal RNAs and protein isolation kit (4478545, Invitrogen, USA) could be used to purify the total RNAs in exosomes. Total RNAs from tumor tissues or cells were harvested by Triquick reagent (R1100, Solarbio, China) and tissue/cell miRNA extraction kit (R2220, Solarbio, China). Then, the collected RNAs were inversely transcribed into cDNAs according to One Step SuperRT-PCR Mix Kit (T2240, Solarbio, China) or miRNA First-Strand cDNA Synthesis Kit (KR211, TIANGEN, China). Thereafter, qPCR was conducted with FastFire qPCR PreMix (FP207, TIANGEN, China) and miRNA qRT-PCR Kit (FP411, TIANGEN, China) under the Thermal Cycler Dice Real Time System III (Takara, China). Oligo (dT)-Universal Tag universal reverse transcription primer was used as the reverse primer of miRNA and U6. The sequence information of primers was exhibited as follows: CDKN2B-AS1 (5′-3′): AGTTAGGGTGTGGTATGTGCC, ACATCCAAGACAGCAAGTGGT; P4HA1 (5′-3′): AGTACAGCGACAAAAGATCCAG, CTCCAACTCACTCCACTCAGTA; GAPDH (5′-3′): TGCACCACCAACTGCTTAGC, CATGCACTGTGGTCATGAG; MiR-122-5p forward primer (5′-3′): TGGAGTGTGACAATGGTGTTTG; U6 forward primer (5′-3′): CTCGCTTCGGCAGCACATATACT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!