Mouse and human tissues were collected and fixed with 3.7% paraformaldehyde (v/v)43 (link),54 (link),55 (link). Briefly, deparaffinized sections were treated with proteinase-K (25 µg mL−1 for 8 min at 37 °C). Double-FAM-labeled miR-103a-3p probe (mmu-miR-103a-3p miRCURY LNA miRNA Detection probe, Cat YD00615519, Exiqon, Denmark) was incubated at 30 nM for 1 h in Exiqon hybridization buffer (Exiqon) at 57 °C. Polyclonal sheep anti-vWF (ab11713, 1:100, Abcam, Cambridge, UK) was incubated at room temperature and detected with Alexa Fluor 555-conjugated donkey anti-Sheep (1:400, Thermo Fisher Scientific, Waltham, MA). And polyclonal Rabbit anti-SNRK (1:100, ab96762, Abcam, Cambridge, UK) was incubated at room temperature and detected with Alexa Fluor 488-conjugated goat anti-Rabbit (1: 400, Thermo Fisher Scientific, Waltham, MA). Slides were mounted with Anti-fade Gold with DAPI (Invitrogen). Image acquisition was performed with confocal microscope (LSM800, Carl Zeiss Microscopy Ltd, Cambridge, MA). The colocalization coefficient was quantified using Zen 2011 software. For each channel, the colocalization coefficient was calculated as the ratio of pixels exhibiting colocalized SNRK to total pixels exhibiting vWF staining. All quantitation was done using original, unmodified data images.
Exiqon hybridization buffer
Manufactured by Qiagen
Sourced in Denmark
The Exiqon Hybridization Buffer is a specialized solution used in the process of hybridization during microarray analysis. It is designed to facilitate the binding of target molecules to their complementary probes on the microarray surface.
Automatically generated - may contain errors
Lab products found in correlation
Lna probe, by Qiagen (2 mentions)
Ab11713, by Abcam (1 mentions)
Ab96762, by Abcam (1 mentions)
Alexa fluor 488 conjugated goat anti rabbit, by Thermo Fisher Scientific (1 mentions)
Blocking reagent, by Roche (1 mentions)
Nuclear fast red, by Vector Laboratories (1 mentions)
Dig blocking reagent, by Roche (1 mentions)
5 brom 4 chloro 3 indolyl phosphate bcip substrate, by Roche (1 mentions)
Axioscan slide scanner, by Zeiss (1 mentions)
Alkaline phosphatase conjugated sheep anti fam fab fragments, by Roche (1 mentions)
5 brom 4 chloro 3 indolyl phosphate substrate, by Roche (1 mentions)
Zen software, by Zeiss (1 mentions)
4 protocols using exiqon hybridization buffer
1
Multiplexed in situ analysis of miRNA and protein
2
In Situ Hybridization of miR-34a in Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ hybridization (ISH) was performed using miR-34a 5’-DIG-labeled LNA™ probes (Exiqon, Vedbaek, Denmark) according to the manufacturer's protocol. The sequence of the detection probe for human mature miR-34a was 5’ ACAACCAGCTAAGACACTGCCA 3’. TMAs composed of intratumoral tissues from 296 patients were prepared as follows: the TMAs were (1) acetylated with 0.25% acetic anhydride after the sections were dewaxed and rehydrated; (2) prehybridized in Exiqon hybridization buffer (Exiqon, Vedbæk, Denmark) at 55°C for 60 min; (3) incubated with 40 μl of a 1:600 dilution of the corresponding 5’-DIG-labeled LNA™ miRNA probe; (4) washed twice with SSC buffer at 60°C for a minimum of 20 min; (5) treated with digoxigenin (DIG) blocking reagent (Invitrogen); (6) incubated with anti-DIG alkaline phosphatase conjugated antibody (Invitrogen) at 4°C for 24 h; and (7) washed twice and counterstained slightly with Mayer's hematoxylin.
3
In Situ Detection of miRNA-30c Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Paraffin sections were mounted on Super frost + glass slides and deparaffinized. The slides were then treated with proteinase-K 10 μg/ml at 37 °C for 10 min, pre-hybridizd in Exiqon hybridization buffer (Exiqon, Vedbæk, Denmark) at 37 °C for 2 h, hybridized with 50 nM miRNA-30c probe and washed stringently with 5 × SSC, 1 × SSC and 0.2 × SSC buffers at 37 °C for 30 min. DIG blocking reagent (Roche, Mannheim, Germany) was added for 1 h at 37 °C in maleic acid buffer with 2% sheep serum. After which, alkaline phosphatase-conjugated anti-digoxigenin was added at 4 °C for 12 h (1:500 in Roche blocking reagent). 4-nitroblue tetrazolium (NBT) and 5-brom-4-chloro-3′-Indolylphosphate (BCIP) substrate (Roche) were used for enzymatic development to form dark-blue NBT-formazan precipitates at 37 °C for 60 min. The sections were lightly counterstained with nuclear fast red (Vector Laboratories, Burlingname, CA) at 25 °C for 1 min and mounted. The expression of miR-30c was detected, using digoxin-labelled locked nucleic acid-modified RNA probes against the full length mature miR-30c sequence. MiR-30c probe sequences are listed in Table S1 .
4
Chromogenic miRNA In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromogenic miRNA ISH was performed essentially as described previously [14] using a Tecan Evo automated hybridization instrument (Tecan, Männedorf, Switzerland). The following steps were performed on 5 μm-thick sections: predigestion with proteinase-K (10 μg/ml) at 37 °C for 8 min, prehybridization at 55 °C for 15 min, incubation with double-carboxyfluorescein (FAM)-labeled locked nucleic acid (LNA) probes (Exiqon, Vedbeak, Denmark) [15] for miR-143-3p (GAGCTACAGTGCTTCATCTCA; predicted RNA Tm, 85 °C), miR-145-5p (AGGGATTCCTGGG AAAACTGGAC; predicted RNA Tm, 84 °C), and miR-375 (TCACGCGAGCCGAACGAACAAA; predicted RNA Tm, 82 °C) at 20-40 nM in Exiqon hybridization buffer (Exiqon) for 2 h at 55 °C, stringent washes with saline-sodium-citrate (SSC) buffers, detection of the FAMlabeled probes with alkaline phosphatase-conjugated sheep anti-FAM Fab fragments (Roche, Basel, Switzerland), incubation with 4-nitro-blue tetrazolium and 5-brom-4chloro-3′-Indolyl-phosphate substrate (Roche) for 1 h to allow the development of the dark-blue diformazan precipitate at the location of the bound probe, and finally, counterstaining with nuclear fast red. The slides were then dehydrated and mounted. The slides were processed in an AxioScan slide scanner (Zeiss, Oberkochen, Germany) and image acquisition was accomplished using the Zen software (Zeiss).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!