Short hairpin lentiviral particles Snail (sc-38398-V), Slug (sc-38394-V), Twist-1 (sc-38604-V), copGFP shRNA control (sc-108084) and control shRNA (sc-108080) was purchased from Santa Cruz, USA. Transfection was performed as given in the manufacturer’s protocol. Briefly, cells were seeded in 12-well plates and incubated overnight for attachment. The culture medium was replaced with the transfection medium containing 5 µg/mL polybrene (sc-134220, Santa Cruz, USA). Lentiviral particles were added to the culture in pre-optimized MOI values. Cells were incubated for 24 hrs and the culture medium was renewed or cells were split into 1:3. After 5 days of transfection, GFP was observed, and the medium was changed with a complete medium containing 1 µg/mL puromycin dihydrochloride (sc-108071, Sigma Aldrich, USA) for Panc-1, BxPC-3, AsPC-1 and 2 µg/mL for MIA PaCa-2 cells. Puromycin-resistant colonies were selected. Transfected cells were cultured continuously without freezing to eliminate the possible loss of gene silencing in repeated freeze-thaw cycles.
Control shrna sc 108080
Manufactured by Santa Cruz Biotechnology
Sourced in United States
Control shRNA (sc-108080) is a non-targeting short hairpin RNA (shRNA) designed for use as a negative control in RNA interference (RNAi) experiments. It does not target any known mammalian gene.
Automatically generated - may contain errors
Lab products found in correlation
Polybrene, by Santa Cruz Biotechnology (1 mentions)
Puromycin dihydrochloride, by Merck Group (1 mentions)
Firefly luciferase lentivirus, by BPS Biosciences (1 mentions)
D 001810, by Horizon Discovery (1 mentions)
Puromycin, by VectorBuilder (1 mentions)
Puromycin dihydrochloride sc 108071, by Santa Cruz Biotechnology (1 mentions)
5 protocols using control shrna sc 108080
1
Lentiviral Silencing of EMT Regulators
2
Lentiviral Transduction for GCNT1 Modulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture and the cell lines used were as described previously34 (link). The stable cell lines used in the study were created using lentiviral transduction. For knockdown of GCNT1 the following shRNA lentiviral particles were purchased from Santa Cruz (GCNT1 shRNA sc-92945-V and Control shRNA sc-108080). Transductions were carried out according to the manufacturer’s instructions using an MOI of 5. For overexpression of GCNT1 the following Lentifect Purified lentiviral particles were purchased from Tebu-Bio (GCNT1 LPP-Z6088-Lv242-050-S and Negative Control 217LPP-NEG-Lv242-025-C). Transductions were carried out according to the manufacturer’s instructions using an MOI of 5. For the metastasis study, PC3 cells were transduced with Firefly Luciferase Lentivirus (BPS Bioscience, 79692-H) at a MOI of 1 in media containing 5 µg/ml polybrene. Stable cell lines were selected with 200 μg/ml hygromycin, and then further selected for GCNT1 overexpression using the methods described above.
3
Knockdown of CXCR1 and IL-8 in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used pcDNA3.1-His-BQ323636.1. CXCR1 human shRNA plasmid kit (TL312158; Origene, Rockville, MD, USA) was employed. CXCR1 shRNA (sc-40026; Santa Cruz Biotechnology, Dallas, TX, USA), GFP control (sc-108084; Santa Cruz Biotechnology, Dallas, TX, USA) and control shRNA (sc-108080) were purchased. We purchased siRNA against IL-8 (L-004756) and non-targeting siRNA (D-001810) from Horizon Discovery (Cambridge, UK). We purchased siBQ.1 (5′-CUU CUC CAG GUU CUC UGC AUG-3′) and siBQ.2 (5′-CUC CAG GUU CUC UGC AUG CGC-3′) (Sigma-Aldrich, St. Louis, MO, USA) and described them in the published study [22 (link)].
4
Generation of Dual HSP90 Knockdown Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Scrambled control (shControl) and HSP90 knockdown (shHSP90) DU145 and C4-2 cell lines were created using lentiviral based transduction and selection with puromycin, shRNA for HSP90ab were purchased from Santa Cruz Biotechnology, Inc. (HSP90ab# sc-35608-V and Control shRNA# sc-108080). shRNA for HSP90aa were purchased from VectorBuilder Inc. The sequences for HSP90aa and Scramble shRNA are
pLV[shRNA]-EGFP:T2A:Puro-U6 > hHSP90AA1[shRNA#1] shRNA sequence: AGCTGCATATTAACCTTATAC
pLV[shRNA]-EGFP:T2A:Puro-U6 > Scramble[shRNA#1] shRNA sequence: CCTAAGGTTAAGTCGCCCTCG.
5
Silencing FGF-19 in SCC-15 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to transfection, SCC-15 cells were seeded into 6-well plates (2 × 105 cells/well) and cultured for 1 day until the cells reached 60–80% confluence. Then, the cells were transfected with control shRNA or FGF-19 shRNA lentiviral particles. All transfections were performed following the protocol of shRNA lentiviral particle transduction. Stable clones expressing the shRNA were selected via puromycin dihydrochloride, and the selected cells were expanded and collected to conduct shRNA expression analysis by Western Blot and qRT-PCR. Puromycin dihydrochloride (sc-108071), control shRNA (sc-108080), and FGF-19 shRNA lentiviral particles (sc-39480-V) were purchased from Santa Cruz Biotechnology, Inc. (Heidelberg, Germany).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!