Cell were fixed in 4% (vol/vol) paraformaldehyde (Alfa-Aeser) for 15 min at RT, permeabilized with 0.1% (vol/vol) Triton X-100 (EMD Millipore) for 3 min, and blocked with 1% (vol/vol) bovine serum albumin (BSA; Thermo Fisher) for 30 min in a humid chamber. Cells were incubated with primary antibodies for 2 h, rinsed with 1% BSA in PBS, and then incubated with secondary antibodies and phalloidin (3:500; Thermo Fisher Scientific) for 30 min in a humid chamber. The following primary antibodies were used for immunostaining: mouse anti-vinculin hVin-1 (1:1000; Sigma) and YAP (D8H1X) XP Rabbit mAb (1:1000; Cell Signaling). As secondary antibodies we used Alexa Fluor 488 goat anti-mouse (1:500) and Alexa Fluor 488 goat anti-rabbit (1:500), both from Life Technologies. Finally, cells were incubated with NucBlue Live ReadyProbes Reagent (Thermo Fisher Scientific) for 20 min in PBS to stain nuclei. Samples were rinsed in PBS and stored in PBS at 4°C in the dark.
Mouse anti vinculin hvin 1
Manufactured by Merck Group
The Mouse anti-vinculin hVin-1 is a laboratory reagent used for the detection and analysis of vinculin, a cytoskeletal protein that plays a role in cell-cell and cell-matrix adhesion. This monoclonal antibody recognizes the human vinculin isoform and can be used in various immunological techniques, such as Western blotting, immunoprecipitation, and immunofluorescence microscopy, to study the distribution and expression of vinculin in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Triton x 100, by Merck Group (1 mentions)
Nucblue live readyprobes reagent, by Thermo Fisher Scientific (1 mentions)
Bovine serum albumin (bsa), by Thermo Fisher Scientific (1 mentions)
Paraformaldehyde (pfa), by Merck Group (1 mentions)
Alexa fluor 488 goat anti rabbit, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 488 goat anti mouse, by Thermo Fisher Scientific (1 mentions)
Yap d8h1x xp rabbit mab, by Cell Signaling Technology (1 mentions)
Mouse anti tubulin dm1a, by Merck Group (1 mentions)
Mouse anti actin ac 40, by Merck Group (1 mentions)
Mouse anti gfp gf28r, by Thermo Fisher Scientific (1 mentions)
Mouse anti talin 8d4, by Merck Group (1 mentions)
Gfp trap magnetic agarose, by Proteintech (1 mentions)
Anti gapdh 14c10, by Cell Signaling Technology (1 mentions)
Rp 8 cpt camps, by Biolog (1 mentions)
Control sirna, by Horizon Discovery (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
Mouse anti lamina, by Abcam (1 mentions)
Dimethyl sulphoxide, by Merck Group (1 mentions)
Mouse anti active β catenin, by Merck Group (1 mentions)
Epoximicin, by Enzo Life Sciences (1 mentions)
5 protocols using mouse anti vinculin hvin 1
1
Immunostaining of Cellular Proteins
2
Reagents for Cellular Signaling Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rp-8-CPT-cAMPS (8-(4-chlorophenylthio)adenosine-3′,5′-cyclic monophosphorothioate, Rp-isomer) was purchased from either Biolog and Cayman Chemical with no notable differences in efficacy or potency. Reagents for immunofluorescence and immunoblotting were as follows: rabbit anti-paxillin (Y113; Abcam); mouse anti-vinculin (hVin-1; Sigma); rabbit anti-PKA RIIα (sc909; Santa Cruz Biotechnology); mouse anti-talin (8d4; Sigma); PKA-Cα (610980; BD biosciences); Prx3 (PF-PA0255; Abfrontier); rabbit monoclonal anti–phospho-RII (pS99 clone E151, ab32390; Abcam); mouse anti-tubulin (DM1a; Sigma); anti-GAPDH (14C10; Cell Signaling Technologies); mouse anti-actin (AC-40; Sigma); mouse anti-GFP (GF28R; Thermo Fisher); rabbit anti-phospho-PKA substrate (100G7E; Cell Signaling Technologies); and anti-Tns3 antibodies (PA5-63112; Invitrogen and HPA055338; Millipore-Sigma). Secondary reagents were purchased from Jackson ImmunoResearch (Alexa594-and Alexa647-conjugated donkey anti-rabbit and Alexa488-conjugated donkey anti-mouse) and Invitrogen (Alexa488-phalloidin; DAPI (4′,6-diamidino-2-phenylindole)). GFP-Trap Magnetic Agarose was from ProteinTech. Reagents for the synthesis of ATP-biotin were described elsewhere (57 (link)). Unless otherwise noted, other common chemicals and reagents were from Sigma or Fisher.
3
Investigating Wnt/β-Catenin Pathway Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were used: rabbit anti-AXIN1 (C95H11), rabbit anti-AXIN2 (76G6) (Cell Signaling Technology), mouse anti-β-catenin (BD Transduction Laboratories); mouse anti-ubiquitin (Upstate / Millipore), mouse anti-active-β-catenin (05–665, Millipore); mouse anti-β-Actin (Sigma Aldrich), mouse anti-Calreticulin (Enzo lifesciences), mouse anti-Vinculin (HVIN-1, Sigma Aldrich), rabbit anti-FoxM1 (C-20, Santa Cruz), mouse anti-LaminA (Abcam), rabbit anti-p62 (MBL / Nordic Biosite). All secondary antibodies used for confocal microscopy studies were obtained from Jacksons ImmunoResearch Laboratories and secondary antibodies used for Western blotting were obtained from LI-COR Biosciences GmbH. Hoechst (Invitrogen). G007-LK (Gift from Stefan Krauss and Jo Waaler, Oslo, Norway); MG132 (Calbiochem); Dimethyl sulphoxide (DMSO), 3-Methyladenine (3-MA), Lactacystin, PhosSTOP (Sigma Aldrich); Epoximicin (Enzo lifesciences); Leupeptin (Peptanova Gmbh, Peptide Insitute, Japan). Quantitech mRNA primer pairs against TBP (QT00000721), AXIN2 (QT00037639) and FoxM1 (QT00000140) were obtained from Qiagen. FoxM1 siRNA (Sense: 5' GGACCACUUUCCCUACUUUUU-3' , Antisense: 5' AAAGUAGGGAAAGUGGUCCUU 3' [21 (link)], and control siRNA (cat: D-001810-01), Dharmacon. siRNA transfections were performed using RNAiMax (Invitrogen) according to the manufacturer's protocol.
4
Immunofluorescence Staining of Focal Adhesion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were fixed in 4% (vol/vol) paraformaldehyde (Alfa-Aeser) for 10 min at room temperature and rinsed with PBS. Cells were permeabilized in PBS containing 5% (vol/vol) goat serum (Thermo Fisher) and 0.5% (vol/vol) Triton-X (EMD Millipore) for 10 min. Cells were blocked in PBS containing 5% (vol/vol) goat serum for 1–16 h at room temperature or at 4°C, respectively. Coverslips were incubated with primary antibodies for 2–3 h at room temperature, rinsed with 1% (vol/vol) goat serum in PBS, and then incubated with secondary antibodies and phalloidin (Life Technologies) for 1–2 h at room temperature in the dark. Cells were rinsed in PBS and mounted using Fluoromount-G (Southern Biotech).
The following primary antibodies were used for immunostaining: mouse anti-vinculin hVin-1 (1:200; Sigma), rabbit anti-diphosphorylated myosin light chain Thr18/Ser19 (1:200; Cell Signaling Technologies), mouse anti-α-actinin-1 Clone BM 75.2 (1:200; Thermo Fisher), rabbit anti-phosphorylated paxillin Tyr188 (1:200; Cell Signaling Technologies). The following secondary antibodies were used: AlexaFluor 488 anti-rabbit (1:400), AlexaFluor 647 anti-mouse (1:400), phalloidin-AlexaFluor 546 (1:200), all from Life Technologies.
The following primary antibodies were used for immunostaining: mouse anti-vinculin hVin-1 (1:200; Sigma), rabbit anti-diphosphorylated myosin light chain Thr18/Ser19 (1:200; Cell Signaling Technologies), mouse anti-α-actinin-1 Clone BM 75.2 (1:200; Thermo Fisher), rabbit anti-phosphorylated paxillin Tyr188 (1:200; Cell Signaling Technologies). The following secondary antibodies were used: AlexaFluor 488 anti-rabbit (1:400), AlexaFluor 647 anti-mouse (1:400), phalloidin-AlexaFluor 546 (1:200), all from Life Technologies.
5
Immunofluorescence Microscopy of Focal Adhesions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents were acquired from Sigma-Aldrich (St. Louis, MO) unless otherwise specified. Primary antibodies used for immunofluorescence microscopy were mouse anti-vinculin (hVin-1, Sigma; 1:200), rabbit anti-paxillin (GeneTex, Irvine, CA; 1:200), mouse anti-c-myc (9B11, Cell Signalling Technologies, Danvers, MA; 1:200). Alexa Flour 680-conjugated streptavidin was from Life Technologies, and secondary antibodies (anti-mouse IgG Alexa Flour 488 and anti-rabbit IgG Alexa Flour 488) were from Invitrogen (Carlsbad, CA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!