Gene expression of neurotrophic factors and receptors was analyzed by RT-PCR. Total RNA (100 ng) isolated with the RNeasy kit was amplified with QuantiTect One-step SYBR Green and specific primers using an Applied Biosystems 7500 real-time thermocycler (Foster City, CA). Fold changes in neurotrophins expression were normalized to B2M and calculated with the ΔΔCt method (Livak and Schmittgen 2001 (link)).
7500 real time thermocycler
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 real-time thermocycler is a laboratory instrument used for DNA amplification and quantification. It is designed to perform real-time polymerase chain reaction (PCR) experiments. The 7500 provides precise temperature control and detection capabilities to enable accurate analysis of nucleic acid samples.
Automatically generated - may contain errors
Lab products found in correlation
Mirna assay, by Thermo Fisher Scientific (3 mentions)
Taqman mirna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Hiscript 2 one step qrt pcr sybr green kit, by Vazyme (1 mentions)
Originpro 8 sr0, by OriginLab (1 mentions)
Sypro orange, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Retroscript kit, by Thermo Fisher Scientific (1 mentions)
Sybr green 1 real time pcr kit, by GenePharma (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr premix ex taqtm tli rnaseh plus, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Mrna assays, by Thermo Fisher Scientific (1 mentions)
Sybr green real time pcr kit, by Tiangen Biotech (1 mentions)
Trizol reagent, by Tiangen Biotech (1 mentions)
13 protocols using 7500 real time thermocycler
1
Quantification of Neurotrophin Expression
2
Quantification of JFH-1 Viral RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated with TRIzol reagent according to standard protocols. One-step qRT-PCR was performed with HiScript® II One Step qRT-PCR SYBR® Green Kit (Vazyme, China) using an Applied Biosystems 7500 real-time thermocycler (Applied Biosystems, USA). The target gene and GAPDH transcript levels were determined using the ΔΔCT method. To determine the amount of purified JFH-1 virions, the pUC18-JFH1 plasmid was used as a standard sample to generate a standard curve ranging from 103–1011 copies/mL. JFH-1 RNA copies were quantified using the HiScript® II One Step qRT-PCR SYBR® Green Kit (Vazyme, China).
3
Thermal Stability Profiling of Fungal NAT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DSF was performed essentially as described60 (link), each 20 μl reaction containing 3 μg of glycerol-free purified recombinant fungal NAT protein, or protein with 0.4 mM acyl-CoA (acetyl-, n-propionyl-, malonyl- or succinyl-CoA). Reactions were performed in duplicate, with SyproOrange (Invitrogen) in 20 mM Tris-HCl (pH 7.5), 0.5% v/v dimethyl sulphoxide (DMSO). Fluorescence was monitored on a 7500 real-time thermocycler (Applied Biosystems), and the generated sigmoid curves were fitted to the Boltzmann equation to accurately calculate Tm values. Tm peaks of proteins were determined via calculation of the derivative of generated thermal profiles for each set of conditions. Data analysis was performed using software OriginPro 8 SR0 (OriginLab).
4
Quantifying mRNA Levels in Endometriosis Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The m-RNA levels were quantified by TaqMan real-time polymerase chain reaction. RNA from endometriosis samples was isolated using the Trizol® reagent according to the manufacturer’s instructions, and quantified by the Nanodrop® spectrophotometer. Two micrograms of total RNA was used as a template for cDNA synthesis, using the SuperScript II® reverse transcriptase kit (Invitrogen®). TaqMan Universal PCR Master Mix (Applied Biosystems®) and a validated TaqMan assay was purchased from Applied Biosystems, and were used to quantify mouse VEGF (Mm01281449_m1), kinase insert domain receptor (KDR), gene which encodes VEGFR-2 (Mm01222421_m1), MMP-9 (Mm004422991_m1) and PTGS, gene which encodes COX-2 (Mm00478374_m1) expression levels, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Mm99999915_g1) as an endogenous control. Triplicate TaqMan PCR assays for each gene target were performed in cDNA samples. Real-time reactions were conducted in a 7500 Real-Time thermocycler (Applied Biosystems®). The relative quantification of the target genes was performed using the Delta-Delta Ct method.
5
Quantifying Bacterial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from three separate exponential‐phase cultures of WT LP965, EF.A, or L. casei BL23 strains grown in MRS as previously described (Tachon, Lee, & Marco, 2014 ). cDNA was synthesized with the RETROscript kit (Ambion) according to the manufacturer's instructions. Expression of corC was quantified for each strain by quantitative PCR (qPCR). Reactions were performed on an Applied Biosystems 7500 Real‐time thermocycler using 4 ng of RNA, 0.2 µM of each primer (Table A2 ), and Fast Sybr Green Master Mix (Thermo) under the following conditions: 10 min at 95°C and then 40 cycles of 10 s 95°C and 30 s 60°C followed by melt curve analysis. Expression was quantified by the 2−∆∆Ct method using rpoB as an internal control and WT expression levels as the reference condition.
6
Quantitative Analysis of Lung Metastases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative analysis of lung metastases, lungs dissected from mice bearing mammary tumors were snap-frozen in liquid nitrogen and pulverized into a fine powder. DNA was extracted using an NaCl-Tris-EDTA buffer (100 mM NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA) containing 20 μg/ml proteinase K and purified by two phenol/chloroform (1:1 vol/vol) extractions followed by ethanol precipitation. The ratio of cancer cells to normal cells was quantified by measuring the neomycin resistance gene (neor) DNA levels versus the vimentin DNA loading control, as described previously [29 (link)]. TaqMan PCR was performed on an Applied Biosystems 7500 real-time thermocycler (Thermo Fisher Scientific, Foster City, CA, USA). Probe and primer sequences are listed in Additional file 1 : Table S1. The cycling conditions were as follows: 50 °C for 5 minutes, 95 °C for 2 minutes, then 40 cycles of 95 °C for 1 minute and 60 °C for 45 seconds. Fluorescence was measured every cycle after the annealing step, and Ct values were calculated. The data were analyzed using the 2−ΔΔCt method [30 (link)].
7
Quantifying miRNA and mRNA Levels in Lung Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase I-treated total RNA (10 ng) was subjected to microRNA polymerase chain reaction (PCR) analysis with the TaqMan® miRNA Reverse Transcription (RT) Kit (Life technologies, Foster city, CA), miRNA Assays (Life technologies, Foster city, CA), and a Real-Time Thermocycler 7500 (Life technologies, Foster city, CA). RNU6B was used as the small RNA reference housekeeping gene. The following primer sequences were used for amplifyication of the YAP1 gene: the forward primer, 5'- GCTCTTCAACGCCGTCA-3', and the reverse primer, 5'- AGTACTGGCCTGTCGGGAGT-3'. Bcl-2 gene: the forward primer, 5'- CTGTGGATGACTGAGTACC -3' and the reverse primer, 5'- CAGCCAGGAGAAATCAAAC -3'. Slug gene: the forward primer, 5'-GCCTCCAAAAAGCCAAACTACA-3' and the reverse primer, 5'-AGGATCTCTGGTTGTGGTATGACA-3'. IGF1R gene: the forward primer, 5'- ACGGCAGCCAGAGCATGTAC -3' and the reverse primer, 5'- TGCATCCTTGGAGCATCTGA -3'. Bad gene: the forward primer, 5'- GAGCATCGTTCAGCAGCA-3', and the reverse primer, 5'- CATCCCTTCATCTTCCTCAGT-3'. The miR-630 and YAP1 mRNA levels in lung tumors that were higher than the median value were defined as “high”, while levels lower than the median value were defined as “low”.
8
SHP2 Expression in Lung Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase I-treated total RNA was subjected to polymerase chain reaction (PCR) analysis with the Reverse Transcription Kit (Life technologies, Foster city, CA) and a Real-Time Thermocycler 7500 (Life technologies, Foster city, CA). GAPDH was used as the RNA reference housekeeping gene. The following primer sequences were used for amplification of the SHP2 gene: the forward primer, 5'- GGAGTTGATGGCAGTTTTTTGG-3', and the reverse primer, 5'- TCTGAATCTTGATGTGGGTGACA-3'. The SHP2 mRNA levels in lung tumors that were higher than the median value were defined as “high”, while levels lower than the median value were defined as “low”.
9
Quantifying miR-630 and Bcl-2 in Lung Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase I-treated total RNA (10 ng) was subjected to microRNA polymerase chain reaction (PCR) analysis with the TaqMan® miRNA Reverse Transcription Kit Life technologies, Foster city, CA, USA), miRNA Assays (Life technologies, Foster city, CA, USA), and a Real-Time Thermocycler 7500 (Life technologies, Foster city, CA, USA). RNU6B was used as the small RNA reference housekeeping gene. The following primer sequences were used for amplification of the Bcl-2 gene: the forward primer, 5′- CTGTGGATGACTGAGTACC -3′ and the reverse primer, 5′- CAGCCAGGAGAAATCAAAC -3′. The miR-630 and Bcl-2 mRNA levels in lung tumors that were higher than the median value were defined as “high”, while levels lower than the median value were defined as “low”.
10
Comprehensive RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, inclusive of the small RNA fraction, was extracted from cultured cells with TRIzol reagent (TaKaRa Otsu, Shiga, Japan) according to the manufacturer's instructions. cDNA was synthesized with the M-MLV reverse transcriptase (Invitrogen, Grand Island, NY, USA) for miR-218 or with the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa Otsu, Shiga, Japan) for HPV E6/E7. Real-time PCR was performed in a Real-Time Thermocycler 7500 (Applied Biosystems, Foster City, CA, USA) with a SYBR Green I Real-Time PCR Kit (GenePharma, Shanghai, China) for miR-218 or with a SYBR Premix Ex TaqTM (Tli RNaseH Plus) (TaKaRa Otsu, Shiga, Japan) for HPV E6/E7. For normalization, U6 and β-actin were used as the endogenous controls for miR-218 and HPV E6/E7, respectively. The relative expression levels of miRNAs and mRNAs in each sample were tested in triplicate and were calculated and quantified with the 2−ΔΔCt method after normalization for expression of the positive control. The oligonucleotide sequences of the miRNA mimics, the miRNA inhibitors, those used for gene knockdown experiments, the gene cloning primers, the 3′UTR cloning primers, and the 3′UTR mutagenesis primers are summarized in Supplementary Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!