DNA-free RNA was purified from BMDM 9 h after Salmonella challenge using a High Pure RNA isolation kit according to the manufacturer’s instructions (Roche). cDNA was prepared from 1 μg RNA using a mixture containing 100 U MMLV reverse transcriptase, 0.45 mM N6 random hexamer primers (Thermo Fisher Scientific), and 20 U RNAsin Plus RNase inhibitor (Promega). Reverse transcription was performed for 1 h at 42 °C. qRT–PCR was performed in a CFX connect Real-Time System (Bio-Rad). PCR-amplified DNA fragments containing the ssrA, sifA, or rpoD genes were used to generate standard curves. Reactions were prepared using Lunar Universal qPCR Master Mix (New England Biolabs) and incubated at 95 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, and 58 °C for 1 min. Data are expressed as relative expression using the copy number of target gene over copy number of housekeeping gene rpoD.
Lunar universal qpcr master mix
Manufactured by New England Biolabs
Sourced in United States
Lunar Universal qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, optimized for reliable and sensitive detection of target sequences.
Automatically generated - may contain errors
2 protocols using lunar universal qpcr master mix
1
Quantitative RT-PCR Analysis of Salmonella Genes
2
Quantitative RT-PCR Analysis of Immune Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the frozen spleen sections using RNeasy Mini Kit (Qiagen, Germany) and converted into cDNA using QuantiTect Reverse Transcription Kit (Qiagen, Germany). The synthesized cDNA was used as the template to determine the relative expression of immune related genes including Ifng, Il2, Il17a, Il10, Foxp3, Tgfb. The quantitative RT-PCR was performed with a StepOne plus RT-PCR using Lunar Universal qPCR Master Mix (New England BioLabs, USA). The mRNA expression of candidate genes was normalized to the expression level of β-actin and presented as relative quantification using the calculation of 2-ΔΔCt. The primers used in the experiments are listed in the table below:
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| IFN-γ | GCCCTCTCTGGCTGTTACTG | CCAAGAGGAGGCTCTTTCCT |
| IL-2 | AAACTCCCCATGATGCTCAC | GAAATTTCCAGCGTCTTCCA |
| IL-17A | CCATCCATGTGCCTGATGCT | AAGTTATTGGCCTCGGCGTT |
| IL-10 | CGACGCTGTCATCGATTTCTC | CAGTAGATGCCGGGTGGTTC |
| FoxP3 | TCATGGGCCCTCAAAGTTAC | GTGTGGTTTTCTGGGATGCT |
| TGFβ | CTTTGTACAACAGCACCCGC | TAGATTGCGTTGTTGCGGTC |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!