Hpa023296

Lentivirus particles were produced by calcium phosphate transfection of 293 T cells and harvested after 24 h–48 h using standard procedures. One to two passages after thawing, BJ-4F3, HUH7, CAKI2 cells were transduced with control shRNAs (Sigma: SHC001 as empty vector, SHC002 as non-targeting shRNA control) or ALDH7A1-specific shRNAs (Sigma: TRCN0000028424 (sh1) and TRCN0000028447 (sh2)) for 24 h, allowed to recover for 24 h, and placed under puromycin selection (2 μg/ml) for 6 days. Experiments were performed within the next 10 passages. All experiments were performed at least 3 times with independently transduced cells. Knockdown efficiency was assessed by quantitative RT-PCR (qPCR) (forward primer: CATGGCGTGAGTGAAGGAC, reverse primer: CAGGGCAATAGGTCGTAATAACC), and/or by immunoblotting of cell extracts using rabbit anti-ALDH7A1 (Sigma: HPA023296).

Liver and kidney cancer arrays presenting tumors and adjacent normal tissue biopsy samples were obtained from US Biomax (Rockville, MD, USA; HLiv-HCC180Sur-02, HLiv-HCC180Sur-03 and HKid-CRC180Sur-01). Additionally, 72 archival patient samples from the pathology department, Rigshospitalet Copenhagen were examined. Ethical approval was obtained from the Danish National Committee on Biomedical Research Ethics. Immunostaining was performed using rabbit anti-ALDH7A1 (Sigma: HPA023296) [31 (link)] and the streptavidin–biotin peroxidase complex method according to the manufacturer’s instructions (UltraVision HRP DAB system, Thermo). Sections were examined by an experienced pathologist to confirm the tissue identity and assigned a score: 0 (no staining), 1 (weak staining up to 10% of tissue), 2 (weak staining 10–25% of tissue), 3 (weak to moderate staining ≥50% of tissue), 4 (moderate to strong staining of 50–75% of tissue) and 5 (moderate to strong staining > 75% of tissue). The score for each tumor was calculated by subtracting the score of the normal tissue from that of that tumor.