For cell-specific gene expression, 2,000 or 10,000 sort-purified cells were collected in RNA lysis buffer, and RNA was extracted by using a Quick-RNA kit (Zymo Research, Irvine, Calif). For whole skin gene expression, ears were snap-frozen, minced, homogenized by using 5-mm stainless steel beads and a Tissue Lyzer II (Qiagen, Germany), and RNA was extracted by using Trizol (ThermoFisher) and the Quick RNA kit (Zymo Research). cDNA was synthetized by using the High-Capacity RNA-to-cDNA kit (Applied Biosystems, ThermoFischer). Reverse-transcriptase quantitative PCR was performed with a QuantStudio 7 (Applied Biosystems) and following the manufacturer’s guidelines, with use of SYBR Green Master Mix and the following probes (for Gapdh, forward 5’-AATGGTGAAGGTCGGTGTGA and reverse 5’-GCAACAATCTCCACTTTGCCA; for Furin, forward 5’-ACACACAGATGAATGACAAC and reverse 5’-GCATTGTAAGCTACACCTAC; and for Dsg1, forward 5’-AAGGCAGAAACGAGAATGGA and reverse 5’-CGAGATGCGGTATGTCACTG) or Taqman Master Mix (all from ThermoFisher) as a duplex with the probes described in Table E3 (in the Online Repository at www.jacionline.org ). Transcript levels were expressed as the ratio of 2−ΔCT to glyceraldehyde-3-phosphate dehydrogenase.
Quick rna kit
Manufactured by Zymo Research
Sourced in United States, Germany
The Quick-RNA kit is a product designed for the rapid and efficient extraction of high-quality RNA from a variety of biological samples. The kit utilizes a spin-column-based approach to isolate RNA, providing a straightforward and streamlined workflow.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 sybr green 1 master mix, by Roche (6 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (6 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (5 mentions)
Superscript 3 first strand synthesis supermix, by Thermo Fisher Scientific (5 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (5 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Superscript 3, by Thermo Fisher Scientific (4 mentions)
Rneasy kit, by Qiagen (3 mentions)
Perfecta sybr green fastmix, by Quantabio (3 mentions)
Qscript cdna synthesis kit, by Quantabio (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Biomek i7, by Roche (3 mentions)
Universal pcr master mix, by Thermo Fisher Scientific (3 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Quantifast sybr green pcr kit, by Qiagen (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Qscript cdna supermix, by Quantabio (2 mentions)
83 protocols using quick rna kit
1
qPCR Analysis of Gene Expression
2
Quantitative PCR Analysis of Organoid RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from organoids was isolated using either an RNeasy kit (Qiagen) or Quick-RNA kit (Zymo). Reverse transcription was carried out by using the High-Capacity RNA-to-cDNA Kit (ThermoFisher). Quantitive PCR was performed using the QuantiFast SYBR Green PCR Kit (Qiagen) using primers for Hprt (fwd: cctcctcagaccgcttttt, rev: aacctggttcatcatcgctaa), Actb (fwd: actaatggcaacgagcggttc, rev: ggatgccagaggattccatacc), Lyz1 (fwd: ggcaaaaccccaagatctaa, rev: tctctcaccaccctctttgc), Lyz1 (fwd: gccaaggtctacaatcgttgtgagttg, rev: cagtcagccagcttgacaccacg), Defa, fwd: aatcctcctctctgccctcg, rev: accagatctctcaatgattcctct), Yap1 (fwd: tggccaagacatcttctggt, rev: caggaacgttcagttgcgaa), Wwtr1 (fwd: tggggttagggtgctacagt, rev: ggattgacggtcatgggtgt), Gapdh (fwd: tgttcctacccccaatgtgt, rev: tgtgagggagatgctcagtg), Olfm4 (fwd: ggatcctgaacttttggtgct, rev: acgccaccatgactacagc), and Wnt3 (fwd: ctcgctggctacccaattt, rev: gaggccagagatgtgtactgc). Samples were commonly analyzed in duplicate and RNA expression was calculated either normalized to reference gene, or additionally normalized to control conditions.
3
Quantifying mRNA Expression with SYBR Green
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted with a Quick-RNA™ kit (Zymo Research Corp, Irvine, CA, USA). The first-strand cDNA was synthesized with SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen). Relative mRNA quantification was determined with SYBR Green I MasterMix (Roche, Basel, Switzerland) on a CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). Each sample was measured at least three times. The relative mRNA levels were determined with the 2 -∆∆CT method, with GAPDH serving as the loading control. The primer sequences are listed in Supplementary Table 1.
4
Quantitative RT-PCR Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Quick-RNA kit (Zymo Research) according to the manufacturer’s instructions. Total RNA (1 µg) was subjected to reverse-transcription using qScript cDNA SuperMix (QuantaBio, VWR). Real-time quantitative PCR (RT-qPCR) were performed with the Roche LightCycler® 480 instrument and the PerfeCTa SYBR Green FastMix (QuantaBio, VWR) and were carried out in a final volume of 10 μL using 0.25 µL of each primer (25 μM), 5 μL of the supplied enzyme mix, 2.5 μL of H2O, and 2 μL of the template diluted at 1:10 [see Supplementary Table 1 for primer sequences]. After pre-incubation at 95 °C, runs corresponded to 35 cycles of 15 s each at 95 °C, 5 s at 60 °C, and 15 s at 72 °C. Melting curves of the PCR products were analyzed using LightCycler® software to exclude amplification of unspecific products. The results were normalized to different housekeeping gene transcripts (mouse RS9 or human 28S)[30 (link)].
5
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from cells with GenElute (Sigma-Aldrich), a PureLink RNA kit (Invitrogen), or a Quick-RNA kit (Zymo Research). Purified RNA was reverse-transcribed using a high-capacity cDNA synthesis kit (Applied Biosystems). qPCR was carried out with a CFX Connect Real-Time PCR Detection System (Bio-Rad) using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). The sequences of primers used were as follows: 18S ribosomal RNA (internal control for normalization (5′-GTAACCCGTTGAACCCCATT-3′; 5′-CCATCCAATCGGTAGTAGCG-3′), mouse Nr2f6 (5′-GAGGACGATTCGGCGTCAC-3′; 5′-GTAATGCTTTCCACTGGACTTGT-3′), human NR2F6 (5′-GAGCGGCAAGCATTACGGT-3′; 5′-GGCAGGTGTAGCTGAGGTT-3′), mouse Nacc1 (5′-GCGGCTACAGGGACTATACTG-3′; 5′-CCGGAAGTAAGAGCTACTAGCG-3′), Human NACC1 (5′-CTGGCTCCTACCACAATGAGG-3′, 5′-TGGCCGACGTTCATCATGC-3′), mouse Fkbp10 (5′-TACTGCCGTTGCTGTTGCTT-3′; 5′-GGGATGTGGTATCTCTCGATGAC-3′), Human FKBP10 (5′-TACAGTAAGGGCGGCACTTAT-3′; 5′-GAGGACGTGAAAGACCAGCG-3′), and mouse Cxcl10 (5′-CCAAGTGCTGCCGTCATTTTC-3′; 5′-GGCTCGCAGGGATGATTTCAA-3).
6
Quantitative Analysis of FASN Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Quick-RNA Kit (Zymo Research, Irvine, CA, USA), according to the manufacturer's protocol. The rst strand of cDNA was synthesized via reverse transcription by M-MLV Reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR analysis was performed using 2 µL of PCR product. TaqMan probes for human FASN (Fatty-acid synthase) and the Universal PCR Master Mix were purchased from ABI (Foster City, CA, USA). Hypoxanthine phosphoribosyl-transferase 1 (HPRT1) was used as a housekeeping gene. The delta Ct (ΔCt) obtained was used to nd the relative expression of genes, according to the following formula: relative expression = 2-ΔΔCt, where ΔΔCt = ΔCt of respective genes in experimental groups -ΔCt of the same genes in control group.
7
Quantifying Gene Expression via qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Quick-RNA Kit (Zymo Research, Irvine, CA). To transcribe the total RNA to cDNA, the qScript cDNA Synthesis Kit (Quantabio, Beverly, MA) was used. Next, we performed quantitative PCR (qPCR) reactions using the SYBR-green reaction mix (Bio-Rad, Hercules, CA) detected with the ABI 7500 Fast Real-Time PCR System (Thermo Fisher, Waltham, MA). Relative expression levels to ribosomal housekeeping controls (RPL-27) were determined using the comparative threshold method. Stable expression of RPL-27 was confirmed in all conditions. Total RNA for eotaxin-3 was extracted using Monarch Nucleic Acid Purification Kit (New England Biolabs, Ipswich, MA).
8
Transcriptome Profiling of TP53-mutated MDS/AML
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cryopreserved cells from multi-hit TP53-mutated MDS/AML cases in this cohort (N=10), TP53-mutated MDS/AML with tumor-only WGS (N=4), CBF AML (N=11), and normal karyotype AML (M=52) were used for bulk RNA sequencing. RNA was extracted (Quick-RNA kit, Zymo Research) for preparation of total RNA sequencing libraries (TruSeq Stranded Total RNA kit with Unique Dual Indices, Illumina). Paired-end sequencing was performed at McDonnell Genome Institute on NovaSeq S4 flow cells (Illumina) using 2 × 150 bp read lengths to achieve 15Gb of coverage per sample. Transcript abundance was quantified with kallisto[24 (link)] using Ensembl[25 (link)] version 95 and scaled to library size and average transcript length. Normalized read counts were used for differential gene expression by edgeR[26 (link)].
9
Quantifying HIV LTR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using a Quick-RNA kit (Zymo), treated with DNase I, and cDNA synthesized with an iScript cDNA kit (BioRad). Semi-quantitative RT-PCR was performed to detect HIV LTR as previously described [29 (link)] using iTaq SYBR Green master mix (BioRad) on a LightCycler instrument (BioRad) and normalized to the GAPDH housekeeping gene.
10
Spiked RNA-Seq Library Preparation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!