Amv 1st strand cdna synthesis kit

TC cells were seeded in 24-well plates with a density of 10⁴ cells/well and cultured for 24 h at 37 °C. Cells were starving for 12–24 h before stimulation. 0.05 ng/ml, 0.5 ng/ml or 5 ng/ml TGFβ1 for 24 h or 48 h were used for stimulation, and the PI3K inhibitors were added 2 h before TGFβ1 treatment. Cells were washed thrice with cold PBS, and total RNA was isolated and transcribed into single-stranded cDNA using the 1st Strand cDNA Synthesis Kit (AMV, Roche Molecular Systems, Inc., Branchburg, USA) for Reverse Transcription-Polymerase Chain Reaction (RT-PCR) following the recommendations of the manufacturer. cDNA was synthesized from 1 µg of total RNA using PrimeScript^® RT reagent Kit (Takara Bio Inc., Shiga, Japan). PCR was performed with 1 µl of cDNA using GoTaq polymerase (Promega Corporation, Madison, USA) for 25 cycles with specific primers for genes ITGB1 forward primer: GTCTTGGAACGGATTTGATGA and reverse: TTTGCTGGGGTTGTGCTAAT; GAPDH forward: CGGAGTCAACGGATTTGGTCGTAT and reverse: AGCCTTCTCCATGGTGGTGAAGAC. PCR reaction products were resolved through a 0.8% agarose gel in 1 × TAE and stained with Gelred (Biotium Inc., Newark, USA).

Total RNA preparation was performed as previously described [14 (link)]. For RT-PCR analyses, cDNA synthesis was performed with the 1st Strand cDNA Synthesis Kit (AMV; Roche Diagnostics, Mannheim, Germany). Semi-quantitative RT-PCR analyses were performed as described. Primers used for RT-PCR analyses were as follows: CD74 sense (s) 5′-GACAGTCACCTCCCAGAACC, CD74 antisense (as) 5′-GGCAGATAGTTGCCGTTCTC; GAPDH s 5′-ATGCTGGCGCTGAGTAC, GAPDH as 5´-TGAGTCCTTCCACGATAC; MET s 5′-ATCGATCTGCCATGTGTGC, MET as 5′-CACATATGGTCAGCCTTGTCC; CD44 s 5′-AATATAACCTGCCGCTTTGC, CD44 as 5′-CAGGTCTCAAATCCGATGCT; MIF s 5′-CCGAGAAGTCAGGCACGTAG, MIF as 5′-ATAGTTGATGTAGACCCTGTCCG; CXCR4 s 5′-GCCGACCTCCTCTTTGTCAT, CXCR4 as 5′-TAGTAAGGCAGCCAACAGGC. All PCR products were verified by sequencing.