Rpn303b

Preheated RNA was spotted on a positively charged nylon membrane (RPN303B, Amersham, USA). The m6A status was probed with anti-m6A antibody (ABE572, Millipore, USA) and detected using ECL detection reagents (P36599, Millipore, MA, USA). The same membrane was also stained with methylene blue (319,112, Sigma, St. Louis, MO) as a control. The global m6A levels in mRNA were quantified with an EpiQuik m6A RNA Methylation Quantification Kit (Colorimetric) (Abcam) following the manufacturer’s protocol.

Genomic DNA was extracted from the tail fin of F1 transgenic loaches. 5 µg of genomic DNA was digested with EcoRV at 37 °C overnight. Digested DNA was separated on 0.7% agarose gel and then transferred to nylon membranes (RPN303B, Amersham, Shanghai, China) using Semi-dry electrometer (1703940, Biorad, Hercules, CA, USA). The reagents and conditions for the membrane transfer were referred to the instructions of the semi-dry film transfer apparatus. The probes were amplified from pT2-krt8-IFN1 coding sequence with primers (krt8-F1: CAGAGGGACTTTGACTCTCCTTTG; IFN1-R5: CGTCCTGGAAATGACACCTTGG) (Table 1) and labeled with the DIG High Prime DNA Labeling and Detection Starter Kit II from Roche. Hybridization and immunological detection were processed according to the manufacturer’s procedures.

We pooled total RNA from three wild-type and three nm3888^−/− mice and selected mRNA by oligo(dT) cellulose, and 5 μg was electrophoresed on a 1% formaldehyde agarose gel. We transferred samples to a nylon membrane (Amersham, RPN303B) and ultraviolet–cross-linked this membrane. We generated Rreb1 probes to the eighth coding exon using PCR (forward primer, 5͊′CACAGACACGTTGACCACC3′; reverse primer, 5′GCACATGAGGTCACACACAG3′) or to the fourth noncoding exon in V7 (forward primer, 5′AGAGGAAAGCCCTTGACACA3′; reverse primer, 5′CTGTGGGTGCCTGAGAAAAT3′) to detect all transcripts and V7, respectively. We radiolabeled probes with α-³²P deoxycytidine triphosphate and performed hybridization overnight at 42°C. We carried out membrane wash steps at 65°C at increasing concentrations of SDS in 2× SSC buffer. We repeated this experiment twice with two sets of pooled mice.